ID: 1037477867

View in Genome Browser
Species Human (GRCh38)
Location 8:19275467-19275489
Sequence ACCGCAGTGAGTCAACCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037477864_1037477867 9 Left 1037477864 8:19275435-19275457 CCCTGCATAGAGCAGGCCTGGGT No data
Right 1037477867 8:19275467-19275489 ACCGCAGTGAGTCAACCTGCAGG No data
1037477862_1037477867 10 Left 1037477862 8:19275434-19275456 CCCCTGCATAGAGCAGGCCTGGG No data
Right 1037477867 8:19275467-19275489 ACCGCAGTGAGTCAACCTGCAGG No data
1037477865_1037477867 8 Left 1037477865 8:19275436-19275458 CCTGCATAGAGCAGGCCTGGGTA No data
Right 1037477867 8:19275467-19275489 ACCGCAGTGAGTCAACCTGCAGG No data
1037477866_1037477867 -7 Left 1037477866 8:19275451-19275473 CCTGGGTACACAGTTTACCGCAG No data
Right 1037477867 8:19275467-19275489 ACCGCAGTGAGTCAACCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037477867 Original CRISPR ACCGCAGTGAGTCAACCTGC AGG Intergenic
No off target data available for this crispr