ID: 1037477868

View in Genome Browser
Species Human (GRCh38)
Location 8:19275468-19275490
Sequence CCCTGCAGGTTGACTCACTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037477868_1037477874 4 Left 1037477868 8:19275468-19275490 CCGCAGTGAGTCAACCTGCAGGG No data
Right 1037477874 8:19275495-19275517 ACTGGCTCTGGAGCAGGCTCAGG No data
1037477868_1037477878 10 Left 1037477868 8:19275468-19275490 CCGCAGTGAGTCAACCTGCAGGG No data
Right 1037477878 8:19275501-19275523 TCTGGAGCAGGCTCAGGGGAGGG No data
1037477868_1037477875 5 Left 1037477868 8:19275468-19275490 CCGCAGTGAGTCAACCTGCAGGG No data
Right 1037477875 8:19275496-19275518 CTGGCTCTGGAGCAGGCTCAGGG No data
1037477868_1037477876 6 Left 1037477868 8:19275468-19275490 CCGCAGTGAGTCAACCTGCAGGG No data
Right 1037477876 8:19275497-19275519 TGGCTCTGGAGCAGGCTCAGGGG No data
1037477868_1037477873 -2 Left 1037477868 8:19275468-19275490 CCGCAGTGAGTCAACCTGCAGGG No data
Right 1037477873 8:19275489-19275511 GGCTGCACTGGCTCTGGAGCAGG No data
1037477868_1037477872 -8 Left 1037477868 8:19275468-19275490 CCGCAGTGAGTCAACCTGCAGGG No data
Right 1037477872 8:19275483-19275505 CTGCAGGGCTGCACTGGCTCTGG No data
1037477868_1037477877 9 Left 1037477868 8:19275468-19275490 CCGCAGTGAGTCAACCTGCAGGG No data
Right 1037477877 8:19275500-19275522 CTCTGGAGCAGGCTCAGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037477868 Original CRISPR CCCTGCAGGTTGACTCACTG CGG (reversed) Intergenic
No off target data available for this crispr