ID: 1037477869

View in Genome Browser
Species Human (GRCh38)
Location 8:19275468-19275490
Sequence CCGCAGTGAGTCAACCTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037477866_1037477869 -6 Left 1037477866 8:19275451-19275473 CCTGGGTACACAGTTTACCGCAG No data
Right 1037477869 8:19275468-19275490 CCGCAGTGAGTCAACCTGCAGGG No data
1037477865_1037477869 9 Left 1037477865 8:19275436-19275458 CCTGCATAGAGCAGGCCTGGGTA No data
Right 1037477869 8:19275468-19275490 CCGCAGTGAGTCAACCTGCAGGG No data
1037477864_1037477869 10 Left 1037477864 8:19275435-19275457 CCCTGCATAGAGCAGGCCTGGGT No data
Right 1037477869 8:19275468-19275490 CCGCAGTGAGTCAACCTGCAGGG No data
1037477862_1037477869 11 Left 1037477862 8:19275434-19275456 CCCCTGCATAGAGCAGGCCTGGG No data
Right 1037477869 8:19275468-19275490 CCGCAGTGAGTCAACCTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037477869 Original CRISPR CCGCAGTGAGTCAACCTGCA GGG Intergenic
No off target data available for this crispr