ID: 1037477872

View in Genome Browser
Species Human (GRCh38)
Location 8:19275483-19275505
Sequence CTGCAGGGCTGCACTGGCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037477865_1037477872 24 Left 1037477865 8:19275436-19275458 CCTGCATAGAGCAGGCCTGGGTA No data
Right 1037477872 8:19275483-19275505 CTGCAGGGCTGCACTGGCTCTGG No data
1037477864_1037477872 25 Left 1037477864 8:19275435-19275457 CCCTGCATAGAGCAGGCCTGGGT No data
Right 1037477872 8:19275483-19275505 CTGCAGGGCTGCACTGGCTCTGG No data
1037477866_1037477872 9 Left 1037477866 8:19275451-19275473 CCTGGGTACACAGTTTACCGCAG No data
Right 1037477872 8:19275483-19275505 CTGCAGGGCTGCACTGGCTCTGG No data
1037477862_1037477872 26 Left 1037477862 8:19275434-19275456 CCCCTGCATAGAGCAGGCCTGGG No data
Right 1037477872 8:19275483-19275505 CTGCAGGGCTGCACTGGCTCTGG No data
1037477868_1037477872 -8 Left 1037477868 8:19275468-19275490 CCGCAGTGAGTCAACCTGCAGGG No data
Right 1037477872 8:19275483-19275505 CTGCAGGGCTGCACTGGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037477872 Original CRISPR CTGCAGGGCTGCACTGGCTC TGG Intergenic
No off target data available for this crispr