ID: 1037483791

View in Genome Browser
Species Human (GRCh38)
Location 8:19328814-19328836
Sequence TTACCTCTGTTTACTATAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037483789_1037483791 5 Left 1037483789 8:19328786-19328808 CCTAGCAGGCCTGTGAGGTAGGA 0: 1
1: 0
2: 7
3: 37
4: 284
Right 1037483791 8:19328814-19328836 TTACCTCTGTTTACTATAGAAGG No data
1037483790_1037483791 -4 Left 1037483790 8:19328795-19328817 CCTGTGAGGTAGGACTTTCTTAC 0: 1
1: 0
2: 2
3: 4
4: 115
Right 1037483791 8:19328814-19328836 TTACCTCTGTTTACTATAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037483791 Original CRISPR TTACCTCTGTTTACTATAGA AGG Intronic
No off target data available for this crispr