ID: 1037485472

View in Genome Browser
Species Human (GRCh38)
Location 8:19342796-19342818
Sequence AATTTAAAGCCCAGAATATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 213}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037485472_1037485476 18 Left 1037485472 8:19342796-19342818 CCAGATATTCTGGGCTTTAAATT 0: 1
1: 0
2: 0
3: 14
4: 213
Right 1037485476 8:19342837-19342859 CATAAGAAAACATGGAGAAAGGG No data
1037485472_1037485473 10 Left 1037485472 8:19342796-19342818 CCAGATATTCTGGGCTTTAAATT 0: 1
1: 0
2: 0
3: 14
4: 213
Right 1037485473 8:19342829-19342851 GCTTTTTCCATAAGAAAACATGG No data
1037485472_1037485479 29 Left 1037485472 8:19342796-19342818 CCAGATATTCTGGGCTTTAAATT 0: 1
1: 0
2: 0
3: 14
4: 213
Right 1037485479 8:19342848-19342870 ATGGAGAAAGGGAAAGAGGAGGG No data
1037485472_1037485475 17 Left 1037485472 8:19342796-19342818 CCAGATATTCTGGGCTTTAAATT 0: 1
1: 0
2: 0
3: 14
4: 213
Right 1037485475 8:19342836-19342858 CCATAAGAAAACATGGAGAAAGG No data
1037485472_1037485478 28 Left 1037485472 8:19342796-19342818 CCAGATATTCTGGGCTTTAAATT 0: 1
1: 0
2: 0
3: 14
4: 213
Right 1037485478 8:19342847-19342869 CATGGAGAAAGGGAAAGAGGAGG No data
1037485472_1037485477 25 Left 1037485472 8:19342796-19342818 CCAGATATTCTGGGCTTTAAATT 0: 1
1: 0
2: 0
3: 14
4: 213
Right 1037485477 8:19342844-19342866 AAACATGGAGAAAGGGAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037485472 Original CRISPR AATTTAAAGCCCAGAATATC TGG (reversed) Intronic
903289449 1:22298747-22298769 AAGTTAAAGTCAAAAATATCTGG - Intergenic
904512247 1:31021645-31021667 AAGATAAAGCCCAGACCATCTGG + Intronic
906413951 1:45604542-45604564 GATGTAAAGCGCAGAATATCTGG - Intronic
907024462 1:51101859-51101881 AAATGAAAGCACAGTATATCAGG - Intergenic
907181235 1:52572129-52572151 TATTTAAATCCCAGAAAATTGGG + Intergenic
909877749 1:80830194-80830216 AAATAAAACCCCAAAATATCAGG + Intergenic
914835352 1:151202117-151202139 AATTTAAATGCCAGAAGATTGGG + Intronic
916349989 1:163838131-163838153 AATTTAAACCCCAGATTCTTTGG + Intergenic
916826477 1:168446731-168446753 AATTTAAATATCAGAAAATCAGG + Intergenic
918691410 1:187484761-187484783 AATTTAAAGCGGAAAATATTAGG - Intergenic
918979088 1:191531858-191531880 AATATAAATACCAGAATTTCTGG - Intergenic
1063772356 10:9218155-9218177 AATTAAAAGCACAAAATTTCTGG + Intergenic
1065848488 10:29766171-29766193 GATTTGAACCCCAGCATATCAGG - Intergenic
1067130590 10:43560865-43560887 AATTAAAATCCCAGAAAAACTGG + Intronic
1068216051 10:53983828-53983850 AATTTAAGGCATAGAATATAGGG - Intronic
1071112155 10:82172361-82172383 AATTTATACCCAAGAATATGTGG + Intronic
1071351946 10:84755379-84755401 GCTTTAAAGCTCAGAAAATCAGG + Intergenic
1072851765 10:98902398-98902420 AGTTTAAAGCCCAAGATCTCAGG + Intronic
1073710364 10:106029974-106029996 AAGTTAAAGCCAAGAAAGTCTGG + Intergenic
1073851811 10:107629360-107629382 AAATTACTGCCCACAATATCAGG + Intergenic
1074480120 10:113811708-113811730 GAGTTAAAGTCCTGAATATCCGG - Intergenic
1074606680 10:114977938-114977960 TATTTAAATACCAGACTATCAGG - Intergenic
1075553256 10:123409707-123409729 ATTTAAAACCCCAGAATTTCAGG + Intergenic
1075899657 10:126030520-126030542 AATGTAAAGGCTAAAATATCAGG + Intronic
1077070053 11:665625-665647 AATTCAAAGCCCAGCCTTTCAGG + Intronic
1080665256 11:34330244-34330266 AACTCAAAGCCCAAAATACCAGG - Intronic
1080766065 11:35297925-35297947 ATTTTACACACCAGAATATCGGG + Intronic
1082961605 11:58923357-58923379 CGTTTAAACCCCAGACTATCTGG - Intronic
1086108492 11:83173058-83173080 GATCTAAAGCCCAGAAGACCAGG + Intronic
1088058473 11:105612994-105613016 CATTTACACCCCAGAATATAAGG - Intronic
1089142408 11:116296514-116296536 TATTTAAACCCCAGAAAATAGGG + Intergenic
1089205563 11:116758980-116759002 AATTAAAAGTTCAAAATATCAGG + Intronic
1091868494 12:3864798-3864820 AATTTCTAGCCCAGCAGATCAGG - Intronic
1092895539 12:13006891-13006913 ATTTTAAAGTCCAGATTATTTGG + Intergenic
1093137413 12:15468826-15468848 AAATTAAAGCCCAGAAGTTAAGG - Intronic
1093222301 12:16437251-16437273 AATTTATAGACCAGATTGTCGGG + Intronic
1095280150 12:40341772-40341794 AATTTAAAGCCAAATATCTCTGG - Intronic
1096071814 12:48779788-48779810 AAGTTAGAGCCCAGAACCTCTGG - Intronic
1098198289 12:68025683-68025705 ATTTTATGGCCCAGAATATATGG - Intergenic
1099426380 12:82528896-82528918 AACTAAAAGTCCAGAAAATCTGG + Intergenic
1100783208 12:98051200-98051222 TATTTTAAGCCTAGAAAATCTGG + Intergenic
1102758015 12:115359290-115359312 AAATTGAAGCCCAGATTATCTGG - Intergenic
1103184225 12:118942610-118942632 TTTTAAAAGCCGAGAATATCTGG - Intergenic
1106986394 13:35357021-35357043 AAATGAAAGTCCATAATATCAGG - Intronic
1107228751 13:38083723-38083745 ATATGAAACCCCAGAATATCTGG + Intergenic
1108798426 13:54062799-54062821 AATTAAAAAACCAGAATATTTGG + Intergenic
1109122295 13:58472747-58472769 CATTTAAAGATCAGAATATTAGG - Intergenic
1109316284 13:60753674-60753696 AATTTAAATTTCAGAATTTCTGG - Intergenic
1110443441 13:75550073-75550095 AAATTAAATCCCAGAATCCCTGG - Intronic
1111637208 13:90920418-90920440 GATTTTAAGCCCAAAAGATCTGG - Intergenic
1111846746 13:93519109-93519131 AATTTAAAGCTTAAACTATCTGG + Intronic
1112658668 13:101481604-101481626 AAGTTAAAACCCTGAATATCTGG + Intronic
1113284550 13:108831855-108831877 AATCAAAGGCCCAGAAGATCTGG + Intronic
1116268806 14:42733120-42733142 AATTTAAAGCAAATAATACCAGG + Intergenic
1116572801 14:46539192-46539214 AGTTCAAACCCCAGCATATCAGG + Intergenic
1118011048 14:61610950-61610972 AATGTCAAGCCCAGAGAATCAGG - Intronic
1119350936 14:73965107-73965129 AATTTAAAGACAAGAATTTTAGG + Exonic
1120561853 14:86004391-86004413 AATTTAATGTCCTGAAAATCAGG - Intergenic
1121586611 14:95067326-95067348 AATGTAAAGCACAGAAGATGAGG + Intergenic
1124472666 15:30002168-30002190 TATGAAAAGGCCAGAATATCAGG - Intergenic
1127833869 15:62774210-62774232 AATACAAAGCCCAGGATAGCAGG - Intronic
1129059676 15:72850796-72850818 AATTTAGAGCCCTGAATCTCTGG + Intergenic
1131797729 15:96036816-96036838 AGTGTAAATCCCAGAATACCAGG + Intergenic
1131894394 15:97010078-97010100 AACTTTCAGGCCAGAATATCTGG + Intergenic
1133673730 16:8049405-8049427 ATTTTAATGCCAAGAAAATCAGG + Intergenic
1134543107 16:15085307-15085329 AAAGTAAAGCACAGAATACCTGG - Intronic
1135360691 16:21811444-21811466 AAAGTAAAGCACAGAATACCTGG - Intergenic
1135651744 16:24212385-24212407 TTTTTAAAGCACAGAATATGGGG - Intronic
1137980367 16:53064234-53064256 AATCTAGAGCACAGAAGATCTGG - Intronic
1138248785 16:55486714-55486736 GATTGAAAGCCCAGAAAACCTGG + Intronic
1138304356 16:55960700-55960722 AATTTACAGTCCAGTATCTCTGG - Intergenic
1141788790 16:86218878-86218900 AATTTAAAGCCCAGTTTAAACGG + Intergenic
1149077543 17:52614665-52614687 TATTTAAAACCCAGAATTTCTGG + Intergenic
1149412019 17:56418620-56418642 AAATTAAAGCAGAGATTATCTGG + Intronic
1150961598 17:69918837-69918859 AATTTAAAGCAAAGAAAATGAGG - Intergenic
1153939524 18:9966194-9966216 AATTTAAAGCTTATAATTTCTGG - Intergenic
1153985287 18:10345337-10345359 TATTTAAAGCTCAGTATCTCAGG - Intergenic
1155706177 18:28816591-28816613 AATTCAAATACCAAAATATCTGG + Intergenic
1157571325 18:48714244-48714266 TAGTTTAAGCCCAGAATATTAGG - Intronic
1158263355 18:55633575-55633597 TATTTTAAACCCAGAATACCTGG + Intronic
1159571913 18:70124181-70124203 AGTTTAAAGGACAGAATAACAGG + Intronic
1162223797 19:9202560-9202582 TATTTAAAGCCAAAAATCTCTGG + Intergenic
1163658220 19:18560558-18560580 AAATTAAAGCCAAGAATTGCAGG - Intronic
926069834 2:9878173-9878195 ATTTTAAAGCAGAGATTATCAGG - Intronic
926913577 2:17873219-17873241 AATTCAAAGTCCAGCATTTCAGG - Intergenic
927342994 2:22003642-22003664 ATTTTTAAGCCCAGTATATTTGG + Intergenic
927707091 2:25303109-25303131 AGTTTAAAGCCCAGAATTTATGG - Intronic
928870063 2:35965317-35965339 ATGATAAAGCCCAGAATATAAGG + Intergenic
929093324 2:38240872-38240894 AAGTTGAAGCCCACAATTTCTGG - Intergenic
929186691 2:39102608-39102630 ATTTTGAAGTCCAGAAGATCAGG + Intronic
929396103 2:41524359-41524381 ATTTAAAATCCCAGAAAATCAGG - Intergenic
930629633 2:53738095-53738117 AATTGTAAGCCCATGATATCAGG + Intronic
930655837 2:54006492-54006514 AAGTTCAAGCCCAGAAGTTCTGG - Intronic
930831190 2:55744982-55745004 AATTTTAAGCCCAAATTGTCTGG - Intergenic
930983260 2:57553717-57553739 AATTTAAAGCACATTATGTCTGG + Intergenic
932855262 2:75227137-75227159 AATTCAAAGTCCAGGATTTCTGG + Intergenic
933468944 2:82695264-82695286 AATTTAAATCACAGCAGATCAGG + Intergenic
934957893 2:98639674-98639696 AATTTAAAGCCCAACATTTTGGG + Intronic
939398229 2:141659727-141659749 AAATTAAAGCCAAGAATAGAAGG + Intronic
940154133 2:150635882-150635904 AATGCAAAGCCTAGGATATCAGG - Intergenic
940752105 2:157637759-157637781 AATTCAAATCCAATAATATCTGG + Intergenic
942485458 2:176435077-176435099 AATTTCATGCACAGATTATCAGG - Intergenic
942589517 2:177527044-177527066 AATTAAAAGCCTAAAATGTCTGG + Intronic
943502003 2:188703253-188703275 ATCGTAAAACCCAGAATATCTGG + Intergenic
943881095 2:193144232-193144254 AATTTAAAGGTAAGAATAACAGG + Intergenic
944942036 2:204639282-204639304 TAGTTAAAGACCAGAATTTCTGG + Intronic
945932707 2:215871431-215871453 TCTTTAAAGATCAGAATATCTGG + Intergenic
947088444 2:226482101-226482123 AAATTGAGGCCCAGAACATCAGG + Intergenic
1178131564 21:29578508-29578530 AATTCAAAGCCCAGAAACTCTGG - Intronic
1179405196 21:41120166-41120188 TATTTAATTCCCAGAGTATCAGG - Intergenic
1179985111 21:44916232-44916254 ATTTTAAAGGCCACAATTTCTGG + Intronic
1180055134 21:45354120-45354142 ACTTTAAAGTCCAGCATAGCAGG + Intergenic
949169201 3:978518-978540 AATTAGAAGCTCAGAATATTGGG + Intergenic
951981723 3:28574817-28574839 AATTCAAAGCCCAGAATAATGGG + Intergenic
952021220 3:29023494-29023516 AACTTAAAGCCCAGAGTCTATGG + Intergenic
952872559 3:37913788-37913810 AATAGAAAGCCCAGAAACTCAGG - Intronic
955485446 3:59430247-59430269 AATTTAAAGCAGAGATCATCTGG + Intergenic
955858532 3:63300726-63300748 AATTTACAGTCTAGAATAACTGG + Intronic
955986749 3:64581601-64581623 AATTTATAGCCTAGAATTACCGG + Intronic
957886031 3:86288904-86288926 AATTTAGATCCAAAAATATCAGG + Intergenic
958940755 3:100310910-100310932 ATTTTAAAACCTAGAAAATCTGG + Intronic
959331898 3:105016748-105016770 TACTAAAAGCCCAGAATTTCCGG + Intergenic
964645531 3:158955044-158955066 TATTTAAAGGCCAGAAGCTCAGG + Intergenic
965339044 3:167463386-167463408 ATTTTAAAAACCAGAATAACAGG + Intronic
965493821 3:169373306-169373328 AATTTATAGACCAAAATATATGG - Intronic
966162776 3:176985509-176985531 AACTTAAAGTCCAAAATATCTGG + Intergenic
968499215 4:938746-938768 AAATTAAAGCCCATAATAAATGG + Intronic
969900589 4:10345449-10345471 AAATTCAAGCCCAGAAGAGCAGG - Intergenic
970294745 4:14616824-14616846 AAATGGAGGCCCAGAATATCAGG + Intergenic
971864175 4:32147395-32147417 AGATTAAAGCCCAGGCTATCTGG + Intergenic
972291413 4:37693470-37693492 AATGTGAAGGCCAGAATCTCTGG + Intergenic
972793532 4:42395076-42395098 AAAATAAAGTCCACAATATCTGG - Intergenic
974659516 4:64867938-64867960 ACTATAAAGCCCAGAGGATCGGG + Intergenic
975294763 4:72721018-72721040 GATTTAGAGCCCAGATAATCTGG - Intergenic
975944183 4:79684758-79684780 AAAATAAAGCTAAGAATATCAGG + Intergenic
976791013 4:88878736-88878758 AATTTAAGGCCCATAAATTCTGG + Intronic
976854728 4:89590259-89590281 AAGTTAAACCCCAGAGTGTCAGG - Intergenic
978961842 4:114689075-114689097 AATTTAAAGCCCAGAAGGGGAGG - Intergenic
979342001 4:119535878-119535900 AATTTAAAACCCAAAATAAATGG - Intronic
979653645 4:123165981-123166003 AATATGAAGCCAAAAATATCAGG - Intronic
979790734 4:124777969-124777991 AATTTGAAAGCCAGGATATCTGG - Intergenic
982689647 4:158533246-158533268 AATTTAAAGCCAAGAAGGTGAGG + Intronic
984173077 4:176384501-176384523 AATGTAAACCCCATAATATTTGG + Intergenic
987461719 5:18219752-18219774 AATTTAAACCCTAAAATATTTGG + Intergenic
988012245 5:25504132-25504154 AATTTATGGCCCAGAATGTGTGG + Intergenic
988025774 5:25686890-25686912 CATTTCAACTCCAGAATATCTGG + Intergenic
990087865 5:52000930-52000952 AACTTAAATCCTACAATATCAGG - Intergenic
990125097 5:52506550-52506572 CATTTAAAGCCCGCAATATTAGG - Intergenic
990494001 5:56328701-56328723 CAATCAAATCCCAGAATATCTGG - Intergenic
992035025 5:72764777-72764799 AATCTTGAGCCCAGAATAGCTGG - Intergenic
992244538 5:74806541-74806563 GATTTAAAACCTAGTATATCAGG + Intronic
992971185 5:82059895-82059917 AATTTGAAGCCAAGCATATTAGG + Intronic
993750736 5:91663904-91663926 ACTTTACAGCCCAGAACAGCAGG + Intergenic
994521191 5:100838221-100838243 CTTTTAAAGATCAGAATATCTGG - Intronic
994815793 5:104586288-104586310 CACTTAAAGCTCTGAATATCAGG + Intergenic
995151506 5:108852541-108852563 AATTTGAATTCCAGAATATAAGG - Intronic
996090796 5:119349719-119349741 TATTTAAAGCATTGAATATCAGG + Intronic
998609531 5:143672908-143672930 ATATAAAAGCCCAGAAAATCAGG + Intergenic
1000436184 5:161212489-161212511 CATTTAAAGTCCATAATATCTGG + Intergenic
1000614122 5:163409125-163409147 TTTTTAAAGCTCAGAATATGGGG + Intergenic
1002336007 5:178478730-178478752 GCTTTAAACCCAAGAATATCTGG - Intronic
1003285370 6:4729437-4729459 AATCTAAAGCCCAGACCAACTGG + Intronic
1003600977 6:7517110-7517132 AGTTTGAAGCCCAAAAGATCTGG - Intergenic
1004217143 6:13713002-13713024 AATTTAAGGCCAAGATTATCTGG + Intergenic
1007660572 6:43483177-43483199 AAGTTAAAGCCCACACTGTCTGG + Intronic
1008311034 6:49974122-49974144 AATTTAAAGCCCTGAGCTTCAGG - Intergenic
1008330976 6:50244092-50244114 AAATTAAAGTCCAAGATATCTGG + Intergenic
1010480809 6:76351266-76351288 AATTTAAAGTCAGGAATATCTGG + Intergenic
1010867867 6:81002194-81002216 AATTTTAAGCCCAGGCAATCTGG - Intergenic
1013018539 6:106185105-106185127 AATTTCCATTCCAGAATATCTGG + Exonic
1013137264 6:107294637-107294659 ATTTTAAAAATCAGAATATCTGG - Intronic
1013319247 6:108970876-108970898 AATTTAATGTTCAGAAAATCTGG + Intronic
1015770810 6:136766337-136766359 AATTTAAAAACCAGAATAGCTGG + Intronic
1016491122 6:144604042-144604064 ATTTTAAAGCCCAGTGGATCTGG - Intronic
1021582740 7:22174397-22174419 AATTTAAAAGTCAGAAGATCTGG + Intronic
1023215652 7:37859771-37859793 AATTGAAAGGCCAGGATATTGGG - Intronic
1023238546 7:38116881-38116903 CATTTGCAGCCCAGAATTTCAGG + Intergenic
1023397634 7:39766127-39766149 AATTTATAGCCTAGTATTTCTGG + Intergenic
1024822988 7:53355831-53355853 AATTAAAAACCCAGAACATGTGG + Intergenic
1028151791 7:87382156-87382178 AAGCTAAAGCCCAGTATCTCAGG + Exonic
1028628823 7:92909986-92910008 AAATGAAAGCCCAGACTATAAGG - Intergenic
1029889988 7:103918100-103918122 AAATTAAACTCCAGAAAATCCGG + Intronic
1030201588 7:106911158-106911180 CATTTAAAGCTCAGAAAATTTGG + Intergenic
1030212194 7:107007465-107007487 GCTTTAAGGCCCAGAATCTCAGG + Intergenic
1030762750 7:113371363-113371385 AATTTAGAGCTCATAATCTCAGG + Intergenic
1032573851 7:133031055-133031077 AATTTATAGCCCAGAAATTTTGG - Intronic
1032960782 7:137031102-137031124 GATTCAAAAGCCAGAATATCAGG + Intergenic
1034293772 7:149952521-149952543 AAATTAAAGCTCAGAGTATGGGG + Intergenic
1034812294 7:154144333-154144355 AAATTAAAGCTCAGAGTATGGGG - Intronic
1037485472 8:19342796-19342818 AATTTAAAGCCCAGAATATCTGG - Intronic
1042968618 8:74383335-74383357 AATTTAAAGCCAATACCATCTGG - Intronic
1042968698 8:74384469-74384491 AATTTAAAACCCACAAAATTTGG + Intronic
1043076093 8:75701435-75701457 AATTTGTAGCTCAGAACATCAGG - Intergenic
1043539543 8:81243989-81244011 AATTTCAAGCTCACAAAATCTGG - Intergenic
1044130699 8:88520763-88520785 ATTATCAAACCCAGAATATCAGG + Intergenic
1045987652 8:108267641-108267663 AATTTATAGCCAAGAATTTTTGG + Intronic
1046451746 8:114401451-114401473 AAATTTAAGCCCAGAATTTTTGG - Intergenic
1046540462 8:115574201-115574223 ACTTTAGAGACCAGTATATCAGG + Intronic
1047258912 8:123238573-123238595 AATTCAAAGCCTAGTATATTTGG - Intronic
1048194378 8:132320215-132320237 AATGTGAAGACTAGAATATCAGG + Intronic
1048278985 8:133090807-133090829 AATTAAAACCCCAGTCTATCTGG + Intronic
1048640940 8:136360766-136360788 GAGATAATGCCCAGAATATCTGG - Intergenic
1050713371 9:8491616-8491638 AATTTAATGCCCTGAAGAGCAGG - Intronic
1052426880 9:28315932-28315954 AATTTGAAACTCAGAAGATCTGG - Intronic
1052745587 9:32437311-32437333 AAATTAAAACCCAGAAAGTCTGG + Intronic
1058014732 9:100017857-100017879 AATTTATACCCCAGAAGATTTGG + Intronic
1058515397 9:105767585-105767607 AATTTAAAGGCCTAAATAACTGG - Intronic
1058526683 9:105866082-105866104 AATTTGAACCCAAGTATATCTGG - Intergenic
1059840281 9:118207507-118207529 AATTTAAAGAGCATAATAGCAGG + Intergenic
1059840884 9:118214417-118214439 AATTTTAAGCCAAGATTATATGG - Intergenic
1060017771 9:120101781-120101803 ATTTTTAAGCCCAGAAAATCTGG + Intergenic
1062229304 9:135472598-135472620 AATTAAAAGCCCAGATTCCCAGG + Intergenic
1186652015 X:11571315-11571337 GATTTAAACCCCAGCCTATCTGG - Intronic
1187109766 X:16284793-16284815 ACTTTGAAGCACAGAATATGTGG + Intergenic
1188056823 X:25550913-25550935 AATCTTAAGCCCAGAAAATGAGG - Intergenic
1188882464 X:35506089-35506111 ACTTTACATCCCAGGATATCAGG + Intergenic
1189020870 X:37338113-37338135 AAATTAAAGCACAGGATGTCTGG - Intergenic
1189043463 X:37567401-37567423 AATTTAACCCCCATAATAACAGG - Intronic
1192723806 X:73727075-73727097 AAGGAAAAGCCCAGAATATAGGG + Intergenic
1193588511 X:83357865-83357887 AGTTCAAAGCCCATAATCTCTGG - Intergenic
1195401285 X:104464146-104464168 AGATTAAAACCCAGAATGTCTGG - Intergenic
1195800000 X:108698019-108698041 AATCTAAAGCTTAGAATCTCTGG + Intergenic
1196317032 X:114239280-114239302 GCTTTAAAGCCCATAATATTTGG - Intergenic
1196749708 X:119104854-119104876 AATCAAAAGCCAAGAATGTCAGG + Intronic
1197483514 X:127017074-127017096 AATAAAAAACCCACAATATCAGG - Intergenic
1197925215 X:131638938-131638960 AATGTAAAGTACAGAATAACAGG + Intergenic
1200016350 X:153166587-153166609 AACTGAAACCCCAGGATATCAGG - Intergenic
1200372517 X:155741715-155741737 AATTTCCAACCCAGAACATCTGG + Intergenic