ID: 1037485479

View in Genome Browser
Species Human (GRCh38)
Location 8:19342848-19342870
Sequence ATGGAGAAAGGGAAAGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037485472_1037485479 29 Left 1037485472 8:19342796-19342818 CCAGATATTCTGGGCTTTAAATT 0: 1
1: 0
2: 0
3: 14
4: 213
Right 1037485479 8:19342848-19342870 ATGGAGAAAGGGAAAGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037485479 Original CRISPR ATGGAGAAAGGGAAAGAGGA GGG Intronic
No off target data available for this crispr