ID: 1037486805

View in Genome Browser
Species Human (GRCh38)
Location 8:19355727-19355749
Sequence CTAAGACACTAACATGGTGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037486801_1037486805 14 Left 1037486801 8:19355690-19355712 CCATCCATCACAGATGTTGTGTG 0: 1
1: 0
2: 2
3: 15
4: 136
Right 1037486805 8:19355727-19355749 CTAAGACACTAACATGGTGCCGG No data
1037486798_1037486805 27 Left 1037486798 8:19355677-19355699 CCCATTATGTTGCCCATCCATCA 0: 1
1: 0
2: 0
3: 4
4: 122
Right 1037486805 8:19355727-19355749 CTAAGACACTAACATGGTGCCGG No data
1037486800_1037486805 15 Left 1037486800 8:19355689-19355711 CCCATCCATCACAGATGTTGTGT 0: 1
1: 0
2: 1
3: 12
4: 148
Right 1037486805 8:19355727-19355749 CTAAGACACTAACATGGTGCCGG No data
1037486799_1037486805 26 Left 1037486799 8:19355678-19355700 CCATTATGTTGCCCATCCATCAC 0: 1
1: 0
2: 1
3: 7
4: 116
Right 1037486805 8:19355727-19355749 CTAAGACACTAACATGGTGCCGG No data
1037486803_1037486805 10 Left 1037486803 8:19355694-19355716 CCATCACAGATGTTGTGTGGAGT 0: 1
1: 0
2: 0
3: 12
4: 125
Right 1037486805 8:19355727-19355749 CTAAGACACTAACATGGTGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037486805 Original CRISPR CTAAGACACTAACATGGTGC CGG Intronic
No off target data available for this crispr