ID: 1037487235

View in Genome Browser
Species Human (GRCh38)
Location 8:19358969-19358991
Sequence CACCTGGATTTCCCCATGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037487228_1037487235 -4 Left 1037487228 8:19358950-19358972 CCCCTCCACTCCAAGCCATCACC 0: 1
1: 0
2: 5
3: 44
4: 696
Right 1037487235 8:19358969-19358991 CACCTGGATTTCCCCATGCCTGG No data
1037487230_1037487235 -6 Left 1037487230 8:19358952-19358974 CCTCCACTCCAAGCCATCACCTG 0: 1
1: 0
2: 4
3: 32
4: 461
Right 1037487235 8:19358969-19358991 CACCTGGATTTCCCCATGCCTGG No data
1037487232_1037487235 -9 Left 1037487232 8:19358955-19358977 CCACTCCAAGCCATCACCTGGAT 0: 1
1: 0
2: 2
3: 12
4: 192
Right 1037487235 8:19358969-19358991 CACCTGGATTTCCCCATGCCTGG No data
1037487225_1037487235 3 Left 1037487225 8:19358943-19358965 CCCTCCGCCCCTCCACTCCAAGC 0: 1
1: 0
2: 4
3: 50
4: 411
Right 1037487235 8:19358969-19358991 CACCTGGATTTCCCCATGCCTGG No data
1037487223_1037487235 10 Left 1037487223 8:19358936-19358958 CCTCGGCCCCTCCGCCCCTCCAC 0: 1
1: 0
2: 14
3: 142
4: 1245
Right 1037487235 8:19358969-19358991 CACCTGGATTTCCCCATGCCTGG No data
1037487227_1037487235 -1 Left 1037487227 8:19358947-19358969 CCGCCCCTCCACTCCAAGCCATC 0: 1
1: 0
2: 5
3: 57
4: 662
Right 1037487235 8:19358969-19358991 CACCTGGATTTCCCCATGCCTGG No data
1037487222_1037487235 14 Left 1037487222 8:19358932-19358954 CCAGCCTCGGCCCCTCCGCCCCT 0: 1
1: 0
2: 6
3: 79
4: 1002
Right 1037487235 8:19358969-19358991 CACCTGGATTTCCCCATGCCTGG No data
1037487224_1037487235 4 Left 1037487224 8:19358942-19358964 CCCCTCCGCCCCTCCACTCCAAG 0: 1
1: 0
2: 4
3: 52
4: 586
Right 1037487235 8:19358969-19358991 CACCTGGATTTCCCCATGCCTGG No data
1037487226_1037487235 2 Left 1037487226 8:19358944-19358966 CCTCCGCCCCTCCACTCCAAGCC 0: 1
1: 0
2: 6
3: 76
4: 795
Right 1037487235 8:19358969-19358991 CACCTGGATTTCCCCATGCCTGG No data
1037487229_1037487235 -5 Left 1037487229 8:19358951-19358973 CCCTCCACTCCAAGCCATCACCT 0: 1
1: 1
2: 0
3: 21
4: 312
Right 1037487235 8:19358969-19358991 CACCTGGATTTCCCCATGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037487235 Original CRISPR CACCTGGATTTCCCCATGCC TGG Intronic
No off target data available for this crispr