ID: 1037491631

View in Genome Browser
Species Human (GRCh38)
Location 8:19401989-19402011
Sequence GGCCTAGGAAAATAGCTACC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037491631_1037491635 3 Left 1037491631 8:19401989-19402011 CCGGGTAGCTATTTTCCTAGGCC No data
Right 1037491635 8:19402015-19402037 TCTTCATCAGTGATGTGGAAAGG No data
1037491631_1037491636 4 Left 1037491631 8:19401989-19402011 CCGGGTAGCTATTTTCCTAGGCC No data
Right 1037491636 8:19402016-19402038 CTTCATCAGTGATGTGGAAAGGG No data
1037491631_1037491637 5 Left 1037491631 8:19401989-19402011 CCGGGTAGCTATTTTCCTAGGCC No data
Right 1037491637 8:19402017-19402039 TTCATCAGTGATGTGGAAAGGGG No data
1037491631_1037491634 -2 Left 1037491631 8:19401989-19402011 CCGGGTAGCTATTTTCCTAGGCC No data
Right 1037491634 8:19402010-19402032 CCTGATCTTCATCAGTGATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037491631 Original CRISPR GGCCTAGGAAAATAGCTACC CGG (reversed) Intergenic
No off target data available for this crispr