ID: 1037491632

View in Genome Browser
Species Human (GRCh38)
Location 8:19402004-19402026
Sequence CACTGATGAAGATCAGGCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037491632_1037491637 -10 Left 1037491632 8:19402004-19402026 CCTAGGCCTGATCTTCATCAGTG No data
Right 1037491637 8:19402017-19402039 TTCATCAGTGATGTGGAAAGGGG No data
1037491632_1037491640 21 Left 1037491632 8:19402004-19402026 CCTAGGCCTGATCTTCATCAGTG No data
Right 1037491640 8:19402048-19402070 CACATTTATAAATACAAAGAGGG No data
1037491632_1037491642 27 Left 1037491632 8:19402004-19402026 CCTAGGCCTGATCTTCATCAGTG No data
Right 1037491642 8:19402054-19402076 TATAAATACAAAGAGGGGCTAGG No data
1037491632_1037491641 22 Left 1037491632 8:19402004-19402026 CCTAGGCCTGATCTTCATCAGTG No data
Right 1037491641 8:19402049-19402071 ACATTTATAAATACAAAGAGGGG No data
1037491632_1037491639 20 Left 1037491632 8:19402004-19402026 CCTAGGCCTGATCTTCATCAGTG No data
Right 1037491639 8:19402047-19402069 CCACATTTATAAATACAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037491632 Original CRISPR CACTGATGAAGATCAGGCCT AGG (reversed) Intergenic
No off target data available for this crispr