ID: 1037491637

View in Genome Browser
Species Human (GRCh38)
Location 8:19402017-19402039
Sequence TTCATCAGTGATGTGGAAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037491632_1037491637 -10 Left 1037491632 8:19402004-19402026 CCTAGGCCTGATCTTCATCAGTG No data
Right 1037491637 8:19402017-19402039 TTCATCAGTGATGTGGAAAGGGG No data
1037491631_1037491637 5 Left 1037491631 8:19401989-19402011 CCGGGTAGCTATTTTCCTAGGCC No data
Right 1037491637 8:19402017-19402039 TTCATCAGTGATGTGGAAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037491637 Original CRISPR TTCATCAGTGATGTGGAAAG GGG Intergenic
No off target data available for this crispr