ID: 1037498445

View in Genome Browser
Species Human (GRCh38)
Location 8:19462966-19462988
Sequence CAGGGTGGAGAGTAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5230
Summary {0: 1, 1: 20, 2: 273, 3: 1415, 4: 3521}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037498445 Original CRISPR CAGGGTGGAGAGTAGGAGGA GGG (reversed) Intronic
Too many off-targets to display for this crispr