ID: 1037498485

View in Genome Browser
Species Human (GRCh38)
Location 8:19463342-19463364
Sequence CTGTGGGTATGGTGGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 641
Summary {0: 1, 1: 1, 2: 3, 3: 72, 4: 564}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037498485_1037498499 21 Left 1037498485 8:19463342-19463364 CCATCCACCCACCATACCCACAG 0: 1
1: 1
2: 3
3: 72
4: 564
Right 1037498499 8:19463386-19463408 CAGAGGGAGCAACTTTCAGTTGG No data
1037498485_1037498494 5 Left 1037498485 8:19463342-19463364 CCATCCACCCACCATACCCACAG 0: 1
1: 1
2: 3
3: 72
4: 564
Right 1037498494 8:19463370-19463392 CATTCCCATCCCTGCACAGAGGG No data
1037498485_1037498493 4 Left 1037498485 8:19463342-19463364 CCATCCACCCACCATACCCACAG 0: 1
1: 1
2: 3
3: 72
4: 564
Right 1037498493 8:19463369-19463391 ACATTCCCATCCCTGCACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037498485 Original CRISPR CTGTGGGTATGGTGGGTGGA TGG (reversed) Intronic
900154983 1:1200329-1200351 CTGTGGGGATGGAGGGTGTGTGG - Intergenic
900341565 1:2191850-2191872 CTGCGGGTCACGTGGGTGGATGG - Intronic
901194360 1:7432175-7432197 CTGTGGGTATGCTAGGTGCCAGG + Intronic
901417992 1:9129865-9129887 CTGTGTGTGTTGTGAGTGGAAGG + Intergenic
901745962 1:11373634-11373656 GTGTGTGTGTGGTGTGTGGATGG + Intergenic
902380894 1:16051758-16051780 CTGAGGGCATCGTGGCTGGAGGG + Exonic
902542737 1:17166211-17166233 TGGTGGGCATGGTGGGTGGTGGG - Intergenic
902773917 1:18662109-18662131 CTGGGGGTAGGGTGGGTGCTGGG + Intronic
903614404 1:24641734-24641756 TTGTGGTTTTGGTGGATGGAGGG + Intronic
903741808 1:25562736-25562758 TTGTGGGTGTGGTGGGAGGTGGG + Intronic
904016866 1:27428491-27428513 CTGTGGGAAGGGTGGCAGGAAGG - Intronic
904425246 1:30418701-30418723 CTGTGTGTTTTGCGGGTGGAGGG + Intergenic
904567046 1:31434399-31434421 GTGTGGGTGTGGCGGGGGGATGG - Exonic
904876851 1:33661932-33661954 CTGTGTGTGTGGTGGGAGGGAGG - Intronic
905205757 1:36342081-36342103 CTGAGGGTGTGGTGCCTGGAAGG - Intronic
905587633 1:39133212-39133234 CTGGGGGTATGGGGTGTGGTGGG + Intronic
906108169 1:43307017-43307039 TTGTGGGTAGGGTGGGAGGCTGG + Intronic
906326667 1:44850439-44850461 CTGTGGGTGAGGTGGGGGAAGGG + Intergenic
906674165 1:47681235-47681257 CAGTGAGTGTGTTGGGTGGACGG + Intergenic
906869451 1:49461616-49461638 CTGTTGGTAGGGTGGGGGGCTGG - Intronic
907186318 1:52612136-52612158 CAGTGGGTATGGAGGGAGGAAGG - Intergenic
907310442 1:53535925-53535947 GTGTGGGTACGGGGGTTGGAGGG - Intronic
907359544 1:53903378-53903400 ATGTTGGTCTGGTGGCTGGAGGG + Intronic
907512568 1:54972742-54972764 TTCTGGGTTGGGTGGGTGGAGGG + Intergenic
907559722 1:55377573-55377595 CTGTGGGTATGGGAGCTGGGAGG - Intergenic
907676440 1:56521850-56521872 CTGTGGGGATGATGGGTGAGAGG - Intronic
908180212 1:61596496-61596518 CTGTGTGTAAGGGAGGTGGAGGG - Intergenic
908263740 1:62358868-62358890 CTGTGTGTCTGGTGGTTGGCAGG + Intergenic
908494350 1:64679634-64679656 CTGTGGGTCCTGTGGCTGGAGGG + Exonic
909593827 1:77381977-77381999 CTGTGCAGAGGGTGGGTGGAGGG - Intronic
910934486 1:92476208-92476230 CTGTGGGGATGGGAGGGGGAGGG + Intronic
911178667 1:94842396-94842418 AGGTGGGCATGGTGGGTGGGCGG + Intronic
911200526 1:95039112-95039134 GTGTGGGTGTGGTTGGTGAAGGG + Intronic
912558651 1:110534560-110534582 CAGTGAGTATAGTGGGTGGGGGG + Intergenic
912669415 1:111610523-111610545 GTGTGTGTGTGTTGGGTGGAGGG - Intronic
912700291 1:111873223-111873245 CTGTGTGCATTGTGTGTGGAGGG + Intronic
912952928 1:114133038-114133060 CTGAGGGTATGCAGGGAGGAAGG - Intronic
914448671 1:147771940-147771962 CTCTGGGGACAGTGGGTGGAGGG + Intronic
916291642 1:163173425-163173447 GTGTGGGTATGCTGGCTGGCTGG + Intronic
916744085 1:167670883-167670905 ATGGGGGTATGGTTAGTGGAGGG - Intronic
917515327 1:175702424-175702446 CTGTGGGTCTGGAAGCTGGAAGG - Intronic
917749493 1:178041215-178041237 ATGGGGGAATGGAGGGTGGAAGG - Intergenic
918447786 1:184632222-184632244 GTGAGGGTCTGGTGGGTGGGGGG - Intergenic
919686295 1:200486733-200486755 CTGTGGGGAGGGCCGGTGGAGGG - Intergenic
919899700 1:202034861-202034883 GGGTGGGTATGGGGAGTGGAAGG - Intergenic
919972652 1:202591046-202591068 CTGTGGGTGTGGAGAGTGGGAGG + Exonic
921049982 1:211504366-211504388 CTGGGGGTTTGGTGGGTGGTGGG - Intergenic
921881568 1:220260589-220260611 CTGTTGGGGTGGTGGGGGGAGGG + Intronic
921956973 1:220994884-220994906 CTGTGGATGTGGTGGGGAGAAGG + Intergenic
922702431 1:227769698-227769720 CTGTGGTTGTGGAGGGTGGAGGG + Intronic
923092057 1:230748207-230748229 CTCTGGGAATGGGGGGTGCATGG - Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923630462 1:235646354-235646376 CAGCGGGTTTGGTGGGTGGTGGG - Intronic
1062832729 10:616947-616969 CAGTGGGGATGGGGGGTGGTTGG - Intronic
1063039240 10:2319980-2320002 GTGTGTGTGTGGTGGGGGGAGGG - Intergenic
1063137520 10:3230193-3230215 CTGTGGGGATGGTTGGTTGGGGG + Intergenic
1063724481 10:8621832-8621854 CTGGGGGTGTGGTGGGAGGGTGG - Intergenic
1064123634 10:12640464-12640486 CTGTGTGTATGTTGTATGGATGG + Intronic
1066489890 10:35884277-35884299 CTGTGGGAAGGATGGGTGGGAGG - Intergenic
1067013058 10:42732429-42732451 CTGTGTGTGTGGTGTGTGGAGGG - Intergenic
1067310773 10:45111641-45111663 CTGTGTGTGTGGTGTGTGGAGGG + Intergenic
1067421471 10:46154510-46154532 ATGTGTGTGTGGTGTGTGGAGGG - Intergenic
1067506808 10:46860961-46860983 ATGTGTGTGTGGTGTGTGGAGGG - Intergenic
1068689943 10:59905484-59905506 CTTTGGGTTGGGAGGGTGGACGG - Intronic
1069636643 10:69929253-69929275 CTGTGGGTCTGGTTGGGGCAAGG - Intronic
1069818664 10:71214251-71214273 CTTTGGCTATGGAGGGGGGAAGG - Intronic
1070118621 10:73553517-73553539 CTCTGGGAAAGGTGGGAGGAGGG - Intronic
1070791301 10:79191074-79191096 CTATGGGTGTGGGAGGTGGAGGG + Intronic
1070796673 10:79220753-79220775 CTGTGTGTATGGTGTGTGTGAGG + Intronic
1072924020 10:99600344-99600366 CCCTGGGTATGGTGGGAGGTAGG - Intergenic
1072933860 10:99693082-99693104 GTGTGAGTAGGGTGGGAGGATGG + Intronic
1073858025 10:107699841-107699863 CTGTGGGTGAGGTGGGAGGATGG + Intergenic
1073866682 10:107812674-107812696 ATGTGGGTGTGGTGAGGGGAAGG + Intergenic
1074162916 10:110848828-110848850 GGGTGGGTGTGGGGGGTGGAGGG - Intergenic
1074343239 10:112655130-112655152 GGGTGTGTATGGGGGGTGGAGGG - Intronic
1074767894 10:116714036-116714058 GTGGGTGGATGGTGGGTGGATGG + Intronic
1075022025 10:118959158-118959180 CTATGTGTATGGGGGGTGGTGGG - Intergenic
1075455425 10:122581932-122581954 CTGTGGGTTGCGTGGGAGGAAGG + Intronic
1075457548 10:122594635-122594657 CTGTGGGTTGCGTGGGAGGAAGG + Intronic
1075458629 10:122601130-122601152 CTGTGGGTTGCGTGGGAGGAAGG + Intronic
1075459260 10:122605189-122605211 CTGTGGGTTGCGTGGGAGGAAGG + Intronic
1075459892 10:122609248-122609270 CTGTGGGTTGCGTGGGAGGAAGG + Intronic
1075460524 10:122613307-122613329 CTGTGGGTTGCGTGGGAGGAAGG + Intronic
1075461155 10:122617367-122617389 CTGTGGGTTGGGTGGGAGGAAGG + Intronic
1075550767 10:123390868-123390890 CTGGGGGTGAGGTGGGTGTAAGG + Intergenic
1075804333 10:125174628-125174650 TGGTGGGGATGGTGGGAGGAGGG - Intergenic
1075926190 10:126253684-126253706 TTGTGGGTTGGGTGGGGGGAGGG + Intronic
1076420218 10:130326138-130326160 CTGTGGGGTTGGAGGGAGGAAGG + Intergenic
1076689341 10:132213336-132213358 CTGTGGGTGTGTTGGGAAGATGG - Intronic
1076977924 11:189542-189564 CTGTGGGTTTGGGGGGAGGTGGG + Intronic
1077009606 11:374339-374361 CTGTGGGGATGGACGGGGGAAGG + Intronic
1077039343 11:511845-511867 CTGTGTGTGTGGGGGGTGGCTGG - Intergenic
1077077480 11:708099-708121 CTGTTGGTATGGAGGGTCAAGGG - Intronic
1077136727 11:1003258-1003280 CTGTGCTGCTGGTGGGTGGATGG + Intronic
1077159597 11:1106613-1106635 ATGGGTGGATGGTGGGTGGATGG - Intergenic
1077280824 11:1744632-1744654 ATGTGGGTGGGGGGGGTGGATGG + Intronic
1077305574 11:1867334-1867356 GTGTGGGTGTGGTGGGTGGGTGG - Intronic
1077481814 11:2818558-2818580 GTGTGGGGATGGGGGGTGTAAGG - Intronic
1077774795 11:5258847-5258869 CTGTGGCTACTGTGGGAGGATGG - Intronic
1077877412 11:6319996-6320018 ATGTGGGTGTGGTAGGTGGATGG + Intronic
1078134538 11:8640910-8640932 CTGGGTGTATGCTGGGTGGGGGG + Exonic
1078822898 11:14900127-14900149 TTGTGGGTAGGGGGGGTGGGGGG - Intergenic
1079460817 11:20676347-20676369 CTGTGGGTTAGGTTGGGGGAGGG - Intronic
1080366538 11:31580556-31580578 GTGTGTGTATGGTGTGTGAATGG - Intronic
1080383354 11:31796467-31796489 CTGGGGGGATGGAGGGTGGATGG + Intronic
1080686861 11:34523153-34523175 CTGTGTGTATGATGTGTGCATGG - Intergenic
1080911220 11:36600984-36601006 CTGTGGATATGATGGGTTGGAGG + Intronic
1082821176 11:57545791-57545813 CTGTGGGGCTGGAGGGTGGGTGG - Intronic
1083551674 11:63594640-63594662 GTGTGGGTATAGGGGATGGAAGG + Intronic
1084431765 11:69115314-69115336 CTGTGGGTCAGGGGGATGGAGGG + Intergenic
1084774149 11:71364499-71364521 GAGTGGGTAGGGTGGATGGATGG + Intergenic
1084805542 11:71576597-71576619 CTGTGGGAATGGCAGGTGGTGGG + Intergenic
1085073551 11:73571231-73571253 CTGTGGGGAGGGGGGGGGGAGGG - Intronic
1085122158 11:73974162-73974184 CTGTGGCTGTGGAGGGTGGAAGG + Intergenic
1085511718 11:77091594-77091616 CTGTGGGTATGGTGGAGGGTGGG - Intronic
1086352913 11:85961074-85961096 ATGTGTGTATGGGGGGTGGTGGG + Intronic
1087491766 11:98837075-98837097 CTGAGGGTGTGGAGGGTGGAGGG - Intergenic
1087603042 11:100339915-100339937 CTGGGGGTAGGGAGGGTGGAGGG - Intronic
1088263273 11:107965300-107965322 GTGTGTGTATGTTGGGTGGAGGG + Intergenic
1089099981 11:115954545-115954567 CAGTGCATATGGTAGGTGGAGGG + Intergenic
1089118102 11:116112494-116112516 CTGTGGGTGATGAGGGTGGAGGG + Intergenic
1089145800 11:116329021-116329043 GTGTGGGGAAGGTGGGTGCATGG - Intergenic
1089350045 11:117816995-117817017 CTGTGGGCATGGGGGCAGGAGGG - Intronic
1089350411 11:117818799-117818821 CTGTGGGTTTGGAGAGTGAAGGG - Intronic
1089905270 11:122031724-122031746 GAGTGGGGAGGGTGGGTGGAGGG + Intergenic
1090463090 11:126909416-126909438 CTGTGGGTATGCTGGGAGCTGGG - Intronic
1090608709 11:128451367-128451389 CGGTGGGTGGGGTGGATGGAAGG + Intergenic
1091358893 11:134958610-134958632 CTGTGGGAACTGTGGCTGGAGGG + Intergenic
1091796911 12:3302756-3302778 CTGTGGATATGGAGGGCTGATGG + Intergenic
1092056454 12:5511988-5512010 CTGTGTGCATGGGGGGAGGAGGG + Intronic
1093182651 12:15984336-15984358 CTGTGGACAGGATGGGTGGAGGG - Intronic
1094763413 12:33561706-33561728 GTGTGGGCATGGTGGGATGATGG - Intergenic
1096403980 12:51329479-51329501 CTGTGGGTATGTGGAGGGGAGGG + Intronic
1096491575 12:52015612-52015634 CTGTGTGTGTGGAGGGTGGGGGG - Exonic
1096496167 12:52040620-52040642 CTGTGGGTATGATGGGAAGCAGG - Intronic
1096985332 12:55752364-55752386 GTGTGTGTGTGGTGGGTGGGGGG + Exonic
1097081150 12:56432026-56432048 CTGTGGATATGCTGGGCAGAGGG + Intronic
1097187315 12:57202783-57202805 GTGGGGGTATGGTGGGAGCACGG - Intronic
1097269597 12:57765908-57765930 CTGGGGGCATGGTGGGAGGTCGG - Intronic
1098231797 12:68378681-68378703 CTGTGGGAATGGTGGGAGTAGGG - Intergenic
1099084005 12:78222267-78222289 TTGTGTGTGTGGTTGGTGGAAGG + Intergenic
1100259001 12:92914125-92914147 CTGAGGGTGTGGTGGGGGTAGGG - Intronic
1100980146 12:100157124-100157146 CTGTAGGGGTGGAGGGTGGAGGG - Intergenic
1101092642 12:101303554-101303576 CTGTGGGGGTGGTGGGTGCCTGG + Intronic
1101094085 12:101318075-101318097 TGGTGGGGAAGGTGGGTGGAAGG - Intronic
1101851219 12:108403953-108403975 CTGGGTGTATGCAGGGTGGAGGG - Intergenic
1102471243 12:113161088-113161110 CTGTGGGTGTGGGGGTTGGGTGG + Intronic
1102474084 12:113177380-113177402 CTGGGGGCACTGTGGGTGGAAGG - Intronic
1102640254 12:114360735-114360757 ATGGGTGAATGGTGGGTGGATGG + Intronic
1102877321 12:116458526-116458548 ATGGGGGTATGGGGGGTGGGGGG - Intergenic
1103247877 12:119473600-119473622 CTGGGGGAAGGGTGGGAGGAGGG - Intronic
1103931349 12:124452741-124452763 CTGTGGCTTTGGTGGGTTGGAGG - Intronic
1104356279 12:128089795-128089817 ATGTGGGCATGGTGGAGGGAGGG + Intergenic
1104949621 12:132433579-132433601 GTGTGCATATGGTGGGTGCAGGG + Intergenic
1105917639 13:24931859-24931881 CTTTGGGAGAGGTGGGTGGATGG - Intergenic
1106175313 13:27325314-27325336 CTGTAGTTATGGCTGGTGGAAGG + Intergenic
1106428664 13:29658390-29658412 CTGTTGGAAAGGTGGGTGGGGGG - Intergenic
1107598466 13:41988294-41988316 CTGTGGTTATGGCAGGTAGAAGG - Intergenic
1107821196 13:44287135-44287157 CTCAGGGTATTGAGGGTGGATGG + Intergenic
1108439572 13:50436947-50436969 CCTTGGGGATGGTGGGGGGAGGG - Intronic
1108563856 13:51674731-51674753 ATGTGGGTGGGGAGGGTGGAGGG + Intronic
1109924920 13:69124155-69124177 TTGGGGGAATGGTGGGAGGAGGG + Intergenic
1110828553 13:80002295-80002317 CTGTGTGTATGTTGAGGGGAGGG - Intergenic
1111128579 13:83944345-83944367 CTGTGTGTGTGGTGGGGTGATGG + Intergenic
1111474320 13:88725454-88725476 CTGTGGGCATTGTGGATGGCAGG + Intergenic
1111766015 13:92530371-92530393 CTGAGGCTTTAGTGGGTGGATGG - Intronic
1111962462 13:94826188-94826210 CTGGGGGTTTGGGGGGTGGGGGG - Intergenic
1112138814 13:96614495-96614517 TGGTGGGGATGGTGGGTTGAAGG + Intronic
1113406297 13:110043729-110043751 CTGTGTGTATGGTGTATGAATGG - Intergenic
1113682649 13:112255095-112255117 CTGTGGGACTGGTGGGGAGATGG + Intergenic
1113865275 13:113517855-113517877 TTGTGGGGAGTGTGGGTGGAGGG + Intronic
1114186346 14:20405378-20405400 GTGTGGTTATGGTGTGTGGCGGG - Intronic
1114459681 14:22878480-22878502 TGGTGGGTGTGGAGGGTGGAGGG - Exonic
1116303780 14:43221692-43221714 CAGTAGGGATGGTGGGAGGAGGG - Intergenic
1117997336 14:61490106-61490128 CTGTTGGCATGCTGGGTGCACGG + Intronic
1118249170 14:64142348-64142370 CTGTGGTTATTGGGGGTGGTGGG - Intronic
1118441682 14:65817556-65817578 GTGTGTGTATGGTGTGTGTATGG - Intergenic
1118441685 14:65817634-65817656 GTGTGTGTATGGTGTGTGTATGG - Intergenic
1118441693 14:65817806-65817828 GTGTGTGTATGGTGTGTGTATGG - Intergenic
1119492503 14:75048692-75048714 CTGTGAGTATGATGTGTGCATGG - Exonic
1120490228 14:85168778-85168800 CTGTGGGGTTGGCGGGTGCAGGG - Intergenic
1120492657 14:85196204-85196226 CTGTGGGCAAGGTGGATGGACGG + Intergenic
1120704995 14:87736547-87736569 CAGGGGGTGTGGTGGGGGGAAGG - Intergenic
1120736355 14:88057475-88057497 CTGTGGCTGTGGTGGGGGGTGGG + Intergenic
1121088795 14:91167204-91167226 CTCTGGGTATGGTGGGAGAAGGG - Exonic
1121605459 14:95236875-95236897 TTGTGGGAATGGTGTGGGGAGGG + Intronic
1121630410 14:95417819-95417841 CAGTGGGTTAGGTGGGTGGTGGG + Exonic
1122631051 14:103107923-103107945 CTGTGGGGCTGGGGGGTGGAGGG + Intronic
1122741731 14:103875470-103875492 GTGGGGGTGGGGTGGGTGGATGG + Intergenic
1123185459 14:106512392-106512414 CTGAGAGTGTGGTGGGTGCACGG - Intergenic
1124058131 15:26261341-26261363 CTGTTGATATGGTGGGTGGGAGG - Intergenic
1124250787 15:28105406-28105428 GTGTGGGTGTGGTGTGTGTATGG + Intergenic
1125019621 15:34971841-34971863 CAGAGGGTTGGGTGGGTGGAGGG - Intergenic
1125250288 15:37694177-37694199 GTGTGTGTGTTGTGGGTGGAAGG - Intergenic
1125592078 15:40860925-40860947 CTGGGAGTTTGGTGGGTGGAGGG + Intergenic
1126695361 15:51321286-51321308 CTAGGGGCATGGTGGGTGGATGG - Intronic
1127059693 15:55169787-55169809 CGGTGGGGGTGGTGGGTGGGGGG - Intergenic
1127289770 15:57559837-57559859 CTCTGGGTCTGTTGGGGGGATGG + Intergenic
1128016177 15:64349407-64349429 GTGTGGGTATACTGGGTAGAGGG - Intronic
1128331147 15:66756612-66756634 TTGTGGGTATGTGGGATGGAGGG - Intronic
1128390149 15:67177204-67177226 CTATGGCTCTGGTTGGTGGATGG - Intronic
1128719883 15:69940511-69940533 CTGTGTGTGAGGTGGTTGGAGGG - Intergenic
1130069584 15:80635246-80635268 CTGTTGATATGGGTGGTGGATGG + Intergenic
1131668079 15:94591175-94591197 CTGAGGGTGTTATGGGTGGAGGG + Intergenic
1131668816 15:94597893-94597915 TTGTGGAAGTGGTGGGTGGATGG - Intergenic
1132819913 16:1859836-1859858 CTGCGGGTTTGGGGAGTGGATGG + Intronic
1132826471 16:1907900-1907922 CTGTGGAGAGGGTGGGTGCAGGG + Intergenic
1132887738 16:2189871-2189893 CTGTGGGTTTGGGGGGTGCTAGG + Intronic
1132889032 16:2195359-2195381 CTGTGGGGGTGGAGGGAGGAGGG + Intronic
1132889209 16:2195957-2195979 CGGTGCGTGTGGTGGGTGGGGGG + Intronic
1132892358 16:2210552-2210574 CTGTGGGGGTTGTGGCTGGAGGG - Exonic
1133056891 16:3149871-3149893 CCGGGGGGATGGGGGGTGGATGG - Exonic
1133677995 16:8093663-8093685 GTGTGGAAATGGTGGGTTGATGG - Intergenic
1134224877 16:12381906-12381928 GTGTGGGTGGGGTGGGTAGATGG - Intronic
1135546617 16:23371276-23371298 CTGTGGGGAGGGTGGGGTGAGGG - Intronic
1135560213 16:23470372-23470394 GTGTGTGTATGATGGTTGGATGG - Intronic
1135875550 16:26196666-26196688 CAGTGGGCAGGGTGGGTAGAGGG + Intergenic
1137672424 16:50286845-50286867 CTCTGGGTATGGTGTGAGGTAGG - Intronic
1138532727 16:57643549-57643571 CTGGCGGTATGGGGGGTGGGGGG + Intronic
1139122101 16:64033097-64033119 ATGTGTGTGTGGTGGGTGGGGGG - Intergenic
1139375493 16:66494026-66494048 CTGGGGGTATAGTGGGTGCTGGG - Intronic
1140701881 16:77588603-77588625 CTGTGTGTTTGATGGATGGATGG + Intergenic
1141096804 16:81168600-81168622 ATGGGTGGATGGTGGGTGGATGG + Intergenic
1141489540 16:84362884-84362906 CTGTGGGTACGGCGGGAGGACGG - Intergenic
1141665211 16:85462348-85462370 CTGAGGGTAGGGAGGGTGGAGGG - Intergenic
1141800143 16:86302340-86302362 GTATGTGGATGGTGGGTGGATGG - Intergenic
1142032889 16:87847207-87847229 CTGTGGCTCTGGGGTGTGGAGGG - Intronic
1142358443 16:89615050-89615072 CAGTGGGTGTCATGGGTGGAAGG + Intronic
1142465346 17:134007-134029 CTGTGGGTTTGGGGGGAGGTGGG + Intergenic
1143281428 17:5757597-5757619 TTGTGGGGAGGGTGGGAGGAGGG + Intergenic
1145406392 17:22600255-22600277 CTGTGTGTATGATGTCTGGATGG - Intergenic
1145902762 17:28498909-28498931 CTGGGGCTTTGGTGGGTGGGAGG - Intronic
1146798374 17:35798937-35798959 CTGTGTGGATGCTGGGAGGATGG + Intronic
1147306683 17:39569048-39569070 CTGTGGGTGTGGGAGGAGGAAGG - Intergenic
1147624835 17:41893255-41893277 CTGTGGACATGGGGCGTGGAGGG - Intronic
1148243486 17:46014969-46014991 GTGAGGGGATGGTGGGGGGATGG + Intronic
1148744060 17:49908657-49908679 CTGTGGGAATGGGGAGTGGGCGG + Intergenic
1148763627 17:50022778-50022800 CTCTGGGAATGGGGGGTTGAGGG - Intergenic
1148797540 17:50204214-50204236 CTGGGGGGATGGGGGGTGGGAGG + Intergenic
1148799326 17:50213326-50213348 CTGGGGATATGGTGTGTGCAGGG - Intergenic
1148806897 17:50268503-50268525 CTGTGGGCCGGGAGGGTGGAGGG - Intergenic
1148852865 17:50563085-50563107 CTTTGGGGAAGGGGGGTGGAAGG + Intronic
1149054511 17:52347031-52347053 CTGTGTGCAAGGTGGGTGGGGGG + Intergenic
1151156220 17:72124316-72124338 CTGTGGGTCTGCGGGATGGAAGG - Exonic
1151379752 17:73717570-73717592 CTGTGGGATCGGTGGGGGGAGGG - Intergenic
1151602824 17:75116868-75116890 CTGTGAGTGTGGTGGCTGCAGGG - Intronic
1152077611 17:78168919-78168941 CTGGGGGTGGGGTGGGTGGCGGG - Intronic
1152141582 17:78540338-78540360 GGGTGGGTGGGGTGGGTGGATGG + Intronic
1152141702 17:78540770-78540792 GGGTGGGTGGGGTGGGTGGATGG + Intronic
1152446720 17:80349094-80349116 GTGGGGGGATGGGGGGTGGAGGG + Intronic
1153777461 18:8466587-8466609 CCGTGGTTAAGGTGGGTGGAGGG - Intergenic
1154406901 18:14100667-14100689 GAGTGGGTATGGTGGGGAGAAGG + Intronic
1154496077 18:14962632-14962654 CTGTGGGAACTGTGGCTGGAGGG - Intergenic
1154961231 18:21310961-21310983 CTTTGGGTTTGGTGAGTAGAGGG + Intronic
1155177297 18:23312188-23312210 CTGTGGGTATGGTGGGGGACAGG - Intronic
1155963987 18:32019085-32019107 CTGAGGGCATGGTGTGGGGAAGG + Intronic
1157120139 18:44901541-44901563 CTTTGGGTATGATGGGAGGTAGG + Intronic
1157330207 18:46698520-46698542 CTGTTGGCGTGGTGGGTGGTTGG - Intronic
1157764018 18:50284199-50284221 CTGGCGGAATGGTGGCTGGATGG + Intronic
1158932399 18:62334465-62334487 CTCTGTGTAGGGTGGGAGGAGGG + Intronic
1159678364 18:71314860-71314882 CAGTGTGTAGGGTGGGAGGAGGG + Intergenic
1159939139 18:74392725-74392747 GTATGGGTTTGGTGGGTGTAGGG - Intergenic
1160227821 18:77024945-77024967 CTGCGGGTGCTGTGGGTGGAAGG - Intronic
1160632856 18:80258635-80258657 GTGTGGGTGTGGTGTGTGGGTGG + Intergenic
1160665803 19:327639-327661 TTCTGGCTTTGGTGGGTGGAGGG - Intronic
1160818347 19:1046568-1046590 CTGAGGGTCTGGTGGGGGGGGGG + Intronic
1160877886 19:1305886-1305908 CTCTGGGGATGGTGGGGGGGGGG - Intergenic
1160953190 19:1677285-1677307 CTGAGGATCTGGGGGGTGGAGGG + Intergenic
1161031052 19:2057882-2057904 CTGAGGGTGTGGTGGGTCGGGGG + Intergenic
1161347764 19:3776673-3776695 ATGAGTGGATGGTGGGTGGATGG + Intergenic
1161641076 19:5423751-5423773 GTGTGGGTGGAGTGGGTGGAGGG - Intergenic
1161645897 19:5453241-5453263 CTGAGGATATGGTGGATGGAAGG + Intergenic
1161684196 19:5695051-5695073 CTCTGGGCATGGTGGGTGGCAGG - Intronic
1161779613 19:6282744-6282766 CAGGGGGTGTGGTGGGGGGAGGG + Intergenic
1161952768 19:7477067-7477089 CCATGGGCAGGGTGGGTGGAGGG - Exonic
1162903080 19:13806907-13806929 CTTTGTGTAGGGTGGATGGATGG + Intronic
1162958242 19:14111810-14111832 CAGTGGGTGGGGAGGGTGGAGGG + Intronic
1163102747 19:15107808-15107830 CTGAGGGCCTGGAGGGTGGAGGG + Intronic
1163649963 19:18511613-18511635 CCGGTGGTATGGTGGGTGGTGGG - Intronic
1163675463 19:18653529-18653551 CTGATGGAAGGGTGGGTGGATGG - Intronic
1163675500 19:18653640-18653662 CTGATGGAAGGGTGGGTGGACGG - Intronic
1163675578 19:18653872-18653894 CTGATGGAAGGGTGGGTGGATGG - Intronic
1164676375 19:30104304-30104326 CTGTGGAGAGGGTGTGTGGAGGG - Intergenic
1164888176 19:31800943-31800965 CAGGGGGTCTGTTGGGTGGAGGG - Intergenic
1164994910 19:32713894-32713916 CTGTGGGCAGAGTGGGTGGGTGG + Intergenic
1165055906 19:33176294-33176316 CTGCAGGGATGCTGGGTGGATGG + Intergenic
1165149744 19:33753664-33753686 GTGGGGGGATGGTGGGTGGTTGG - Intronic
1165149782 19:33753763-33753785 GTGTGGGGATGGTGGGTGGTTGG - Intronic
1165149809 19:33753843-33753865 GTGGGGGGATGGTGGGTGGGTGG - Intronic
1165149848 19:33753932-33753954 GTGTGGGGATGGTGGGAGGTTGG - Intronic
1166147616 19:40848380-40848402 CTGCGGGTATGGCGGGAGAAGGG + Intronic
1166302352 19:41918529-41918551 GTGTGTGTATGGTGAGTGTATGG - Intronic
1166564593 19:43755727-43755749 CAGTGGGCAGAGTGGGTGGATGG + Intergenic
1166745899 19:45141745-45141767 CTGTGTGAAGGCTGGGTGGAGGG + Intronic
1166877128 19:45904049-45904071 CTGTGTGGAGGGTGGGTGGGAGG + Intergenic
1166975537 19:46603078-46603100 CTGTGGGTGTTGTGGGTGGCAGG - Intronic
1166994604 19:46714209-46714231 GCGTGGGTTTGGTGGCTGGAAGG + Intronic
1167288063 19:48610001-48610023 CTGTTGGTGTGGGGAGTGGAGGG + Intronic
1168387110 19:55973463-55973485 ATGTGGGAATGGTGGGATGAAGG - Intronic
1168697199 19:58410206-58410228 TTGTAGGTATTGTGGGTGGTGGG + Intronic
1168719851 19:58548929-58548951 CTGGGGGTGAGGTGGATGGAGGG + Intronic
925774311 2:7319123-7319145 CTGTGTGTGTGGTGGGGGGAGGG + Intergenic
925848191 2:8052538-8052560 CTGAGGCCATGGTGGGTGGTTGG + Intergenic
926152629 2:10433266-10433288 GTGTGGGAATGGTGTGGGGATGG + Intergenic
926756991 2:16244359-16244381 CCGTGGGCCTGGTGGGAGGAGGG + Intergenic
926775023 2:16413493-16413515 CTGTGGCTATGATGAGTGCAAGG + Intergenic
927086425 2:19677650-19677672 TGGTGGGTATGGTGTGTGGGAGG + Intergenic
927207508 2:20619407-20619429 CTCTGGGCAGGATGGGTGGAGGG - Intronic
927282967 2:21326857-21326879 CTGAGGGGATGGTGTGTAGATGG - Intergenic
927941097 2:27103260-27103282 CAATGGGTATGCTGGGTAGAAGG - Intronic
929024701 2:37588689-37588711 CGGTGTGTATGGTGGGGGCAGGG - Intergenic
929956123 2:46460060-46460082 CTGTGGGCCTGGAAGGTGGAAGG - Intronic
930067069 2:47335797-47335819 CTGTTGGTGGGGTGGGAGGAGGG - Intergenic
930443418 2:51438199-51438221 CTGTGTGTGCAGTGGGTGGAGGG + Intergenic
930909237 2:56610840-56610862 CTGTGGCTCTGGTGGTTGAAGGG - Intergenic
932030768 2:68182077-68182099 GTGTGTGTGTGGTGGGGGGAGGG - Intronic
932369317 2:71174470-71174492 CTGGGAGTGGGGTGGGTGGATGG - Intergenic
932701330 2:73993979-73994001 CTGTGGGTGTGGTGGGTAGGTGG + Intronic
932757420 2:74418034-74418056 CGGTGGTGATGGTGGGTGTAGGG + Intronic
933629442 2:84639142-84639164 CTGTGGGCATGGTGGGGTGGGGG + Intronic
933695326 2:85213140-85213162 CTGTGGCTGGGGTGGGGGGAGGG + Intronic
935498894 2:103814157-103814179 CTGTGGGCATGGTGAGTGTGGGG - Intergenic
936239834 2:110777786-110777808 CTGTGTGTATGTGGGGTTGAGGG + Intronic
936777098 2:115986750-115986772 GTGTGGGTGTGGTGGGGGAAAGG + Intergenic
936899904 2:117470701-117470723 CTGTGGTGGTGGTGGGTGGGGGG + Intergenic
937144812 2:119635499-119635521 CTGTGGATGGGTTGGGTGGATGG + Intronic
937665922 2:124486296-124486318 TTGTGGGGAGGGTGGCTGGAGGG + Intronic
938087105 2:128408833-128408855 CTGTGGTTAGGGTGGGCGGCGGG + Intergenic
938924662 2:136028205-136028227 CCGTGGGCATGGTGGGCCGAGGG + Intergenic
939172213 2:138709439-138709461 CTGTGGGTAGGGAGGGGGGCAGG - Intronic
939216940 2:139250648-139250670 CAGGGGGTGTGGTGGGGGGAGGG + Intergenic
939618010 2:144381906-144381928 CTGTGGGTAGAGAGGTTGGATGG + Intergenic
939639029 2:144617205-144617227 CAGGGGGTGTGGTGGGGGGAGGG - Intergenic
939959356 2:148552635-148552657 ATGTTGGGAGGGTGGGTGGAGGG + Intergenic
940246840 2:151628276-151628298 GTGTGGGTGTGTTGGATGGAGGG - Intronic
941268960 2:163401277-163401299 GTGTTGGTATGGAGGGTAGAAGG - Intergenic
941650196 2:168084172-168084194 AGGTGGGCATGGTGGGGGGAAGG + Intronic
942400617 2:175598273-175598295 CTGTAGGTGTTGTGGGTGGTAGG + Intergenic
944477324 2:200120214-200120236 CTTTGGGTCTGGTGGGTAAAAGG + Intergenic
945042942 2:205757461-205757483 GGATGGGTATGGTGAGTGGATGG + Intronic
946165760 2:217862944-217862966 CTGTAGGTCTGCTGGCTGGAAGG - Intronic
946431961 2:219630919-219630941 GTGTGGGTGGGGTGGGGGGAAGG + Intronic
946816889 2:223588034-223588056 CAGTGGGTTTGGGGGCTGGAAGG - Intergenic
947366691 2:229403733-229403755 ATATGGGTATGGTGGGTGTAGGG + Intronic
947461075 2:230305765-230305787 CTGTGGGCAGGGTGGGTGCAGGG - Intronic
947505596 2:230706127-230706149 GTGTGGGTAGGGTGGAAGGATGG + Intergenic
948004922 2:234600196-234600218 CTGTGTGTGTGGTGGGCGTAGGG - Intergenic
948166670 2:235867866-235867888 CTGGGTGGGTGGTGGGTGGATGG - Intronic
948768129 2:240233743-240233765 CTGTGGGCAGGGTCGGAGGAGGG - Intergenic
948772241 2:240257579-240257601 CTGCGGGGAAGCTGGGTGGACGG - Intergenic
948964101 2:241362933-241362955 CTGTGGTTCTGGGAGGTGGAGGG + Intronic
1168754892 20:309660-309682 CTGTGGGTAAGGAGGCAGGAGGG - Intergenic
1168868529 20:1109296-1109318 CTGTGTGTATGTAGGGTGGTGGG - Intergenic
1169530157 20:6476513-6476535 CTCTGTGTGTGGTGGGGGGATGG + Intergenic
1170036608 20:11996358-11996380 TTGTTGGGGTGGTGGGTGGAGGG - Intergenic
1170475876 20:16713969-16713991 GGGTGGGAATGGAGGGTGGAAGG + Intergenic
1171204794 20:23270398-23270420 GTGGTGTTATGGTGGGTGGAGGG + Intergenic
1172007342 20:31826533-31826555 GTGCGGGTATGGAGGGTGGGTGG + Intronic
1172450858 20:35021653-35021675 CTGGGGGTCTGGTTGGTGGCAGG - Intronic
1173558965 20:43988629-43988651 CTGTGGGTTTCGTGGGGGCAGGG + Intronic
1173663858 20:44751946-44751968 ATGAGGGAAAGGTGGGTGGATGG + Exonic
1173826252 20:46049554-46049576 GTGGGTGTATGGTGTGTGGATGG + Intronic
1174150552 20:48483309-48483331 CAGTGGGGCTGGTGGGTGGGAGG - Intergenic
1174190740 20:48738671-48738693 CTGTGGGTTTGGGGGGAGAAGGG + Intronic
1174394372 20:50237580-50237602 CTGTGGGTATGGATGGTGGCTGG + Intergenic
1174882175 20:54292014-54292036 CTGTGGGTTAGGTGGGGAGAGGG - Intergenic
1175230373 20:57469934-57469956 CTGGGGGTGGGGTGGGTGGGGGG + Intergenic
1175720474 20:61283629-61283651 GTGTGTGTGTGGTGAGTGGATGG + Intronic
1175762949 20:61573532-61573554 CTGTTGGCATGTTTGGTGGAGGG + Intronic
1175793207 20:61755460-61755482 CTGTGTGTATGGTGTGTGTGTGG - Intronic
1175799041 20:61790594-61790616 ATGGGTGGATGGTGGGTGGATGG - Intronic
1176701496 21:10057126-10057148 CTGTGGGTTTGGTGGGTTCGTGG + Intergenic
1177166769 21:17612637-17612659 CTGTGGGTATCGGGGGAGGGTGG - Intronic
1178138074 21:29650796-29650818 CTGTGGGGAAGGTGGCTGGTGGG - Intronic
1179623284 21:42632732-42632754 CTGTGGGACTGGTGGGAGGAAGG + Intergenic
1179644068 21:42764968-42764990 TTGTGGGGTGGGTGGGTGGATGG + Intronic
1179867702 21:44226802-44226824 CAGTGGCTTTGGTGGGTGCAGGG - Intronic
1180019027 21:45108615-45108637 ATGTGGGTGTGGTGGTTGGAAGG - Intronic
1180068090 21:45422717-45422739 CTGTGGGCCTCCTGGGTGGAGGG + Intronic
1180558336 22:16595479-16595501 CTGTGGCCATGGTGGGTGCAGGG + Intergenic
1180593621 22:16960187-16960209 CTTCTGGGATGGTGGGTGGAGGG + Intergenic
1180709944 22:17832730-17832752 CTGTGGGTGTGGTGGGGGGAGGG + Intronic
1180968848 22:19804365-19804387 CTTGGGGTATGGTGCATGGAGGG - Intronic
1181177019 22:21043714-21043736 CTGTGGATAAGCTGGGTGGAGGG + Intergenic
1181621650 22:24095424-24095446 CCGTGGGTGTGGTGGGGGGGTGG - Intronic
1181750147 22:24983595-24983617 ATGTGTGTATGGTGGGGGGGCGG + Intronic
1182073588 22:27479810-27479832 CTGGGGGTGTGGTGGGAGGATGG - Intergenic
1182422859 22:30257020-30257042 CTCTGGACATGGTGGCTGGAAGG - Intergenic
1182513865 22:30840723-30840745 CTTTCTGTATGGTGGGTGGGAGG + Intronic
1182939551 22:34262256-34262278 CTGTGGGCATAGGGAGTGGAGGG + Intergenic
1182980108 22:34661820-34661842 CAGTGGGTATGGTGTGGGGAAGG - Intergenic
1183663290 22:39233883-39233905 CTATGGGAACGCTGGGTGGAGGG - Intronic
1183727582 22:39598054-39598076 CTGTGTGTGTGGTGGGTTGCGGG + Intronic
1184410424 22:44323053-44323075 GGGTGGGTGAGGTGGGTGGATGG - Intergenic
1184410547 22:44323571-44323593 GGGTGGGTGAGGTGGGTGGATGG - Intergenic
1185013882 22:48332429-48332451 GTGTGTGTATGGTGTGTGGGGGG - Intergenic
1185063746 22:48620657-48620679 ATGTGGGGGTGGTGGATGGATGG - Intronic
1185149048 22:49153921-49153943 GTGTGGGTAAGGTGGGAGGAGGG + Intergenic
949565340 3:5239547-5239569 GTGTGTGTATGGTGTGTGTATGG - Intergenic
949941623 3:9159185-9159207 CTGGTGGGATGGTGGGTGGTGGG - Intronic
951668118 3:25149643-25149665 CTGTGGGTATGGGAGGTGAGTGG - Intergenic
952818967 3:37469382-37469404 CTGTGTGTGTGGTGGGTGGTAGG + Intronic
953095362 3:39769654-39769676 CTGTGGGTATGGATGTTGGCAGG - Intergenic
954134123 3:48574352-48574374 CTAGGGGGATGGTGGGTGGAGGG - Intronic
954253872 3:49390073-49390095 CTGTGGGTATTATAGATGGACGG - Intronic
954506049 3:51074673-51074695 CTGGGGGTGTGGTGAGGGGAGGG + Intronic
954690460 3:52392807-52392829 CTGTGGGTGTAGTGGGTGGGGGG - Intronic
954760719 3:52871660-52871682 CTGTGTGGAGGATGGGTGGATGG - Intronic
954794417 3:53154288-53154310 GTGTGGGTGGGGTGGGAGGAGGG + Intergenic
955249379 3:57263388-57263410 GTGTGGGGATGGGGGGTGGGAGG - Intronic
955350402 3:58189270-58189292 CTGGGGGTGGGGTGGGTGAAGGG - Intergenic
955429438 3:58827408-58827430 TTGTGTGTATGTTGGGTGGGGGG + Intronic
956167720 3:66408952-66408974 GTGTGTGTGTGGTGGGGGGAGGG + Intronic
956186898 3:66571260-66571282 CTGTGGGTTAGGTGGGGGTAGGG - Intergenic
956583867 3:70843225-70843247 CTGGGGGTATGGTTAGAGGAAGG + Intergenic
956808140 3:72837238-72837260 CTCTGGGTATGGGGAGTGGAGGG + Intronic
957153416 3:76516286-76516308 GTGTGGGTATGGAGGTAGGATGG - Intronic
960185269 3:114630479-114630501 GTGTGTGTATGGTGGGTGCTAGG + Intronic
961746095 3:129064312-129064334 CTGTGGGTGGAGAGGGTGGAGGG + Intergenic
963525629 3:146411042-146411064 CTGTGTGAATGGTGTGTGGATGG - Intronic
964284819 3:155106656-155106678 TTGGGGGGATGGTGGGAGGAGGG + Intronic
965567193 3:170132570-170132592 TTGAGTGTGTGGTGGGTGGAGGG - Intronic
966044851 3:175535504-175535526 CTGTGGGTATGGTAGGTGTTAGG - Intronic
966313978 3:178625129-178625151 GTGTGGGTCTGGTGGGTGATGGG - Intronic
966839529 3:184077375-184077397 GTGTGGGTGAGGTGGGTAGAAGG + Intergenic
968220949 3:196939708-196939730 CTGAGGATATGGTGTGTGCAGGG - Intronic
968533037 4:1105318-1105340 CTGGGGATGTGGTGGGTGGCTGG - Intronic
968768073 4:2485049-2485071 ATGTGGGTGGGGTGGGCGGAAGG - Intronic
968944558 4:3656768-3656790 CTGTGGGTCTGGCGCGTGGCAGG + Intergenic
969016749 4:4108381-4108403 CTGTGGGGCTGGAGCGTGGAGGG + Intergenic
969054162 4:4391132-4391154 CTTTGGCTCTGGTGGGTGGAAGG + Intronic
969182132 4:5450326-5450348 CTGTGGATATGGTCAGGGGAAGG - Intronic
969526974 4:7708813-7708835 CTGAGGGAGTGGTGGGAGGATGG + Intronic
969662266 4:8537226-8537248 GCGTGGGAAGGGTGGGTGGATGG - Intergenic
969677364 4:8621463-8621485 CAGTGGGTGTGTGGGGTGGAAGG + Intergenic
969678319 4:8627101-8627123 CAGTGGGTGTGTGGGGTGGAAGG + Intergenic
969679275 4:8632739-8632761 CAGTGGGTGTGTGGGGTGGAAGG + Intergenic
969704628 4:8785033-8785055 TTGTGGGAAGGGTGGGTGGAGGG - Intergenic
969832169 4:9806664-9806686 CTGTGTGCATGGGGGGTGGGAGG + Intronic
970093951 4:12441511-12441533 CTGTGGGCAGGCTGGGTGGAGGG - Intergenic
970970014 4:21971525-21971547 CTTTGGGTATGGTGGGAGCTGGG + Intergenic
971132525 4:23828478-23828500 CTGTGGGTTTGGTGTGAGGAGGG + Exonic
971802463 4:31309755-31309777 CTGTGAGTGAGGTGAGTGGAAGG - Intergenic
972433638 4:39010413-39010435 TTGTGTGTGTGGTGGGTGGGTGG - Intronic
973180208 4:47257537-47257559 CTGTGTGTGGGGTGGGTGTAGGG + Intronic
973967764 4:56181473-56181495 TTGTGTGTGTGCTGGGTGGAGGG - Intronic
975025365 4:69542221-69542243 CTGTGGGTTTGTGGGGTGGGAGG - Intergenic
975695480 4:77008600-77008622 CAGTGGGTAGGTTGGATGGATGG + Intronic
976874721 4:89838168-89838190 ATGTGCGTGTGGTGGGTGGGGGG - Intronic
977491383 4:97716693-97716715 CTGTGGGGGTGGGGGGTGGAAGG + Intronic
977523394 4:98113893-98113915 CATTGGGTTTGGTGGGTGTAGGG + Intronic
978270869 4:106888954-106888976 CTGTGGGTAAAGTAGGTGTAAGG - Intergenic
979211948 4:118115332-118115354 CTGTGGGTTTTGTGGCTGTAAGG - Intronic
979312539 4:119220865-119220887 ATGTGGGTGTGGTTGGTGGATGG + Intronic
981229080 4:142331906-142331928 CTGGGGGGGTGGGGGGTGGAGGG + Intronic
981669959 4:147275392-147275414 CGGTGGGGAGGGTGGGTGGTGGG - Intergenic
981801912 4:148667649-148667671 CCGAGGGGATGGTGGGTAGAAGG - Intergenic
982091953 4:151887973-151887995 GTGTTGGTGTGTTGGGTGGATGG + Intergenic
982695730 4:158597810-158597832 CTGTGTGTATGCTGTGGGGATGG - Intronic
982705116 4:158700545-158700567 GTGTGTGTGTGGTGGGGGGAGGG - Intronic
982899650 4:160981838-160981860 CTGTGGGCATTGGGGGTGGAGGG + Intergenic
983442832 4:167809503-167809525 CTCTGGAGGTGGTGGGTGGAAGG - Intergenic
983518190 4:168678805-168678827 ATGTGGGTATGGTGTGTGGGGGG + Intronic
983613098 4:169671748-169671770 GTGTGGGGAAGGTGTGTGGAGGG + Intronic
983634427 4:169882949-169882971 CTGTGGCTTTGCTGGGTGCAAGG - Intergenic
983851984 4:172592408-172592430 GTGTGGGGATGGTGGGAGGTAGG - Intronic
984513073 4:180702125-180702147 ATGTGGGTCAGGTGGGTGGTAGG + Intergenic
985367954 4:189253397-189253419 GAGTGGGTAGGGTGGGAGGAGGG + Intergenic
985561156 5:586698-586720 GTGGGGGAATGGGGGGTGGAGGG + Intergenic
985842398 5:2317927-2317949 CTGTGGGTTTGGTGGGGCCATGG + Intergenic
986125776 5:4881320-4881342 CTGTGTGTGTAGTGGGTGAATGG - Intergenic
986479861 5:8175995-8176017 CTGAGGGCATGGTGGGAGGTGGG + Intergenic
986713957 5:10509141-10509163 ATGTGGTTATGGTGGGAAGAAGG - Exonic
986725742 5:10595098-10595120 CTGTGACTGTGGAGGGTGGAGGG + Intronic
987550113 5:19368702-19368724 CTGTGGGTATGCTAGGTTGCAGG + Intergenic
988923851 5:35969476-35969498 CTTTGGTGGTGGTGGGTGGATGG - Intronic
989322384 5:40151415-40151437 GTGTGGGTTTTGGGGGTGGAGGG - Intergenic
989645183 5:43623197-43623219 ATGTGGGCATGATGGGTGGGTGG + Intronic
990356851 5:54976133-54976155 CTGAAGGGATGGTTGGTGGAAGG - Intergenic
993680698 5:90874163-90874185 CTGTGGCTGTGCTGGGTGAACGG - Intronic
994474794 5:100253161-100253183 GTGTGGGGGTGGTGGGTGGGTGG - Intergenic
996103489 5:119470292-119470314 GTGTGGGCATGGTGGGATGATGG + Intronic
996357674 5:122614999-122615021 CTGTGGGGGTGGTGGGGGGTGGG - Intergenic
996815889 5:127572132-127572154 CTGGGGATTTGCTGGGTGGATGG - Intergenic
997056674 5:130452208-130452230 CTGTGGCTTTAGAGGGTGGAAGG - Intergenic
997438511 5:133892257-133892279 CTGTGGGTATCTGGGGTGGGGGG + Intergenic
997778643 5:136634747-136634769 CTGTGGGTATTCAGGATGGAGGG + Intergenic
997982233 5:138475559-138475581 ATGTGGATATGGTGGGAAGAAGG - Intergenic
999320852 5:150614282-150614304 CTGTGTGTGTGGTGGGGGAAGGG - Intronic
999499226 5:152130171-152130193 CTGTGGTTATTGTGGTGGGAGGG - Intergenic
1001574382 5:172752427-172752449 GTGTGCGTTTGTTGGGTGGAGGG + Intergenic
1002105702 5:176878577-176878599 CTGTGGGTGTGGCAGGTGGAGGG + Exonic
1002279815 5:178123646-178123668 CTGTGGGGATGGTGTGTTTATGG + Exonic
1002475387 5:179462185-179462207 GTGTGGGCGTGGTGGGGGGAGGG - Intergenic
1002569935 5:180134530-180134552 GTGTGGGGATGGTGGGTGCTGGG - Intronic
1002910968 6:1490800-1490822 CTGTAGATGGGGTGGGTGGAGGG - Intergenic
1003005351 6:2376111-2376133 CTGTGTGTGTGTTGGGTGTAGGG - Intergenic
1003469733 6:6418051-6418073 TAGTGGGAGTGGTGGGTGGAGGG - Intergenic
1004238976 6:13901510-13901532 CAGTGGGGATGTTGGATGGAGGG + Intergenic
1004244218 6:13956911-13956933 GTGTGTGTATGGTGGGGGGCGGG - Intronic
1004774017 6:18822020-18822042 CTGTAGCCATGGTAGGTGGAAGG - Intergenic
1004825552 6:19416787-19416809 CTCTGTGTATGGTGTGAGGAAGG + Intergenic
1005492782 6:26361920-26361942 CTGTGGGTAGGGGTGGTGGATGG + Intergenic
1005496947 6:26396041-26396063 CTGTGGGTAGGGGTGGTGGATGG + Intergenic
1005919744 6:30390161-30390183 CTGTGTGTGTGGTGGGGGGCGGG + Intergenic
1006124909 6:31831298-31831320 TTGGGGGGGTGGTGGGTGGAGGG + Intergenic
1006441805 6:34057950-34057972 ATGTGTGTGTGGTGGGTGGGTGG + Intronic
1006800474 6:36756579-36756601 CTTTGGCTATACTGGGTGGAGGG - Intronic
1007126877 6:39432966-39432988 GTGTGGGGGTGGTGGGTGAAAGG + Intronic
1007321107 6:41029213-41029235 CTGTGGGTGTAGTGTGTGCAAGG - Intronic
1007369401 6:41416519-41416541 GTGTGTGTCTGGTGGGTGGAGGG - Intergenic
1008112929 6:47512383-47512405 CTGTGAATATGGAGTGTGGATGG + Intronic
1009479161 6:64134620-64134642 ATGTTGGTGTGGTGGATGGAAGG + Intronic
1009995834 6:70894219-70894241 CTGTGGGCCTGGTTGGTGGGCGG - Exonic
1011164654 6:84432189-84432211 CTGAGTGAATGGTGGATGGATGG + Intergenic
1012247043 6:96937717-96937739 CTGTGAGGATGGAGGGTAGAGGG - Intronic
1012827024 6:104159248-104159270 CTTTGGGTAGGGAGGGTAGAGGG + Intergenic
1013591457 6:111622471-111622493 CTGTGGGTATGGTGGAAAGAAGG + Intergenic
1013749576 6:113388036-113388058 CAGTGGAAATGCTGGGTGGAAGG + Intergenic
1014561479 6:122896224-122896246 CTGTGTGTATGTTGGGTTGTGGG + Intergenic
1014855956 6:126401408-126401430 AAGTGGGTGTGGTTGGTGGATGG + Intergenic
1017905930 6:158757539-158757561 TTGTGGGTGGGGTGGGCGGAGGG + Intronic
1018185557 6:161263034-161263056 CTGATGGTCTGATGGGTGGATGG - Intronic
1019486035 7:1289576-1289598 CTGTGGGTTTGGAGGGTGGAAGG - Intergenic
1019721840 7:2577110-2577132 CTCTGTGTGTGGTGGGTGGGGGG - Intronic
1019821690 7:3248479-3248501 CTGTGTGTATGGTGGGGGCGAGG - Intergenic
1021912678 7:25401878-25401900 CTGTGTGCATGGTGGGGGAAGGG - Intergenic
1022510287 7:30930971-30930993 CTGGGGGTCTGGTGGGAGGCTGG + Intergenic
1022812731 7:33885557-33885579 GTGTGTGTTTGGTGGGGGGATGG - Intergenic
1023582948 7:41701219-41701241 CTGTGGCTTGGCTGGGTGGAGGG - Intronic
1025755227 7:64331984-64332006 CTGTGGGTGTGGTGGTTTCAGGG + Intronic
1025960894 7:66220666-66220688 GTGTGGGGGTGGTGGGTGGGTGG + Intronic
1026564005 7:71474743-71474765 ATGTGGGTATCTTGGGTGGAAGG - Intronic
1026787632 7:73311865-73311887 CTGTGGGTATGGTGAGTCAAAGG + Intergenic
1027557385 7:79682792-79682814 GTGTGTGTGTGGTGTGTGGAAGG + Intergenic
1028009334 7:85620640-85620662 CTGGGGCTTTGGGGGGTGGAGGG + Intergenic
1028488450 7:91385278-91385300 CTATGGGTAAGATGGGTGGGGGG - Intergenic
1028596824 7:92554748-92554770 CTGTGGGAAGGGTGGGAGGAGGG - Intergenic
1028622096 7:92836368-92836390 CTGTGGGTGGGGTAAGTGGAGGG - Intronic
1028702391 7:93795308-93795330 CTGGGGGTGTGGTGAGGGGAGGG - Intronic
1028748002 7:94349375-94349397 CGGGGGGTAGGGTGGGTAGAGGG + Intergenic
1030064433 7:105648600-105648622 CTGTGTGTATGGGAGGTGGGGGG - Intronic
1030416681 7:109252763-109252785 CAGTGGGGAGGGTGGGAGGAAGG + Intergenic
1033279773 7:139997556-139997578 GTGTGTGTATAGTGGGGGGAGGG - Intronic
1033510560 7:142056421-142056443 CTGGGGGTATTGAGGGTGTATGG + Intronic
1033677345 7:143556275-143556297 CTTTGGGCAAGGTGGGTGGCAGG + Intergenic
1033694489 7:143773161-143773183 CTTTGGGCAAGGTGGGTGGCAGG - Intergenic
1034255244 7:149721216-149721238 ATGGGGCCATGGTGGGTGGAGGG - Intronic
1034291234 7:149933254-149933276 CTATGGGGATGGTGGGGAGATGG - Intergenic
1034618980 7:152442530-152442552 CTGTGGCCATGGTGGGTGCAGGG - Intergenic
1034814864 7:154163677-154163699 CTATGGGGATGGTGGGGAGATGG + Intronic
1035636065 8:1145269-1145291 CTGGAGGGATGGTGGGTGGGTGG - Intergenic
1035676926 8:1462592-1462614 CTGTGGCTACCTTGGGTGGATGG + Intergenic
1035842669 8:2829154-2829176 TTCTGGGGAGGGTGGGTGGATGG + Intergenic
1036222758 8:6934410-6934432 CTCTGGGCATTGTGGGTGGTTGG + Intergenic
1036899512 8:12660233-12660255 CTGTGGGGATGGAGCGTGGTGGG + Intergenic
1036900576 8:12666380-12666402 CTGTGGGGATGGAGCGTGGTGGG + Intergenic
1037018348 8:13936859-13936881 CTGTGGGTGGGGTGGAGGGAGGG - Intergenic
1037498485 8:19463342-19463364 CTGTGGGTATGGTGGGTGGATGG - Intronic
1037693991 8:21207899-21207921 CTGTGGGGGTGGGGGGTAGAGGG - Intergenic
1037913926 8:22760595-22760617 GTGTGTGTGTGGTGGGTGCAGGG + Intronic
1039101734 8:33948710-33948732 CTGTTGGAGTGGTGGCTGGAAGG + Intergenic
1039343347 8:36675081-36675103 CTGTGTGTTTGGTGTGTGGGGGG + Intergenic
1040109385 8:43560117-43560139 TTGTGTGAATGGTGAGTGGATGG - Intergenic
1042330620 8:67576798-67576820 GTGTTGGCACGGTGGGTGGAAGG + Intronic
1042373481 8:68019423-68019445 CTGTCGGCAAGGTGGGAGGAAGG + Intronic
1042448841 8:68921277-68921299 GTGTGTGTATGGTGGGGGGGGGG + Intergenic
1042670262 8:71254841-71254863 CTGTGTGTGTGGTGGGGGGCGGG - Intronic
1042743361 8:72075896-72075918 GTGTGTGTGTGTTGGGTGGAGGG + Intronic
1043861409 8:85321568-85321590 CAGTTCATATGGTGGGTGGAAGG + Intergenic
1044419108 8:91971021-91971043 TAGTGGGCATGGTGGCTGGAAGG - Intronic
1045151134 8:99409394-99409416 CTGTGAGTATTGGGGCTGGAGGG + Intronic
1045739143 8:105334150-105334172 GTGTGTGTGTGGTGGGGGGAGGG + Intronic
1045967028 8:108036679-108036701 CTGGGGGTGAGGTGGGAGGAAGG + Intronic
1046140393 8:110083416-110083438 CTGTGGGCATCATGGATGGAAGG + Intergenic
1048148303 8:131867491-131867513 CTGTGGGCTTGGAGGGAGGAAGG - Intergenic
1049297764 8:141852270-141852292 CTGTGGGGGTGGTGGGAGCAAGG + Intergenic
1049320365 8:141993009-141993031 CTGTGCATATGTGGGGTGGAAGG - Intergenic
1049326095 8:142022341-142022363 CTGTGGGCCTGGTGGGGGGTCGG - Intergenic
1049376639 8:142292474-142292496 CTGTGGAGGTGGTGGGTGGCGGG + Intronic
1050402658 9:5272210-5272232 CTGTGGTTATGACTGGTGGATGG + Intergenic
1050430221 9:5554537-5554559 CGAAGAGTATGGTGGGTGGAGGG + Intronic
1050437756 9:5628582-5628604 CTGTGGCTGTGGTGGGCGGTAGG - Intergenic
1050759199 9:9045404-9045426 GTGGGGGTAAGGTGGGTGAAGGG + Intronic
1052840751 9:33289474-33289496 GTGTGGGTCTGGGGGGTGGGGGG + Intergenic
1055056638 9:72030069-72030091 TTGTTGGTTGGGTGGGTGGATGG - Intergenic
1056077807 9:83059604-83059626 GTGTGGGTGTTGAGGGTGGAGGG - Intronic
1056488101 9:87079088-87079110 CGGAGGGCAGGGTGGGTGGAAGG + Intergenic
1057060917 9:92003536-92003558 CTGTAGGTATGATCTGTGGAGGG - Intergenic
1057545937 9:96020757-96020779 CTGTGGGGATGGGGAGTGGACGG + Intergenic
1057704137 9:97385880-97385902 CTGGGGGCCTGGTGGCTGGATGG + Intergenic
1057726358 9:97571283-97571305 CTGGGGGGATAGTGTGTGGAGGG - Intronic
1057817165 9:98304225-98304247 CTGGAGGGATGGTGGGGGGAAGG + Intronic
1057998026 9:99837895-99837917 TTGTGGGAATGGGAGGTGGAGGG + Intronic
1058103106 9:100938225-100938247 CAGTGGGTATGGGAAGTGGATGG + Intergenic
1058621723 9:106890079-106890101 CTGTGGGTATGTTAACTGGATGG - Intronic
1058781517 9:108341239-108341261 TTGTGGTTGTGGTGGGTGGTTGG + Intergenic
1059161289 9:112037740-112037762 GTGTGTGTGTGGTGGGTGGGGGG - Intergenic
1059541634 9:115136269-115136291 GTGTGTGTATGTTGGGGGGATGG + Intergenic
1060395933 9:123316561-123316583 CTGTGGGGATGGGGGTTGGAAGG + Intergenic
1060820950 9:126661425-126661447 CTCTGGGTATGGTGGGTGGAGGG + Intronic
1061012416 9:127963506-127963528 CAGTGGCTGTGGTGGGTGCAGGG - Intronic
1061076512 9:128344707-128344729 CTGTGGTCATGGTGGGTCGAGGG + Intronic
1061284281 9:129613367-129613389 CTGTAGGCAAGGGGGGTGGAGGG + Intronic
1061872897 9:133530098-133530120 CTGTGTGTGTGCTGGGAGGACGG + Intergenic
1062119493 9:134826665-134826687 GTGTGTGTATGGGTGGTGGATGG + Intronic
1062433351 9:136535552-136535574 ATGGGTGCATGGTGGGTGGAGGG + Intronic
1062467508 9:136687647-136687669 CTGTGGGGAGGGAGCGTGGAGGG - Intergenic
1202786513 9_KI270719v1_random:27208-27230 CTGTGGGTTTGGTGGGTTCGTGG + Intergenic
1185581100 X:1211995-1212017 CTGGGTGGATGGTGGATGGATGG + Intronic
1185709724 X:2293809-2293831 GTGTGTGTGTGGTGGGGGGAGGG + Intronic
1186367263 X:8908853-8908875 ATGTGTGCATGGTGGGTGCAGGG + Intergenic
1186747995 X:12589903-12589925 ATGTGGATTTGGTAGGTGGAAGG - Intronic
1186913920 X:14199465-14199487 CTGTCGGTGGGGTGGGGGGAGGG + Intergenic
1187108450 X:16269843-16269865 CGGTGGGTGGGGTGGGGGGAGGG - Intergenic
1189232499 X:39463535-39463557 CTGTGGGAAGGGTGGATGGATGG + Intergenic
1189291338 X:39887987-39888009 CTGTAGGGATGGTGGGTGGCTGG + Intergenic
1189406414 X:40729236-40729258 GTGTGGGTATGGGTGGTGTAGGG - Intronic
1190119754 X:47650395-47650417 CTCTGGGCCTGGAGGGTGGAGGG - Intronic
1190430907 X:50377015-50377037 ATGTGGGTACAGTGGGTAGAGGG + Intronic
1192134254 X:68582279-68582301 CTGAGGGTGTGGTGTGTGCAGGG - Intergenic
1194406309 X:93500134-93500156 TTGGGGGTGTGGTGGGAGGAGGG + Intergenic
1194525966 X:94977922-94977944 CTGTTGGTATGGCAGGGGGAGGG + Intergenic
1194706052 X:97177126-97177148 CCATGGATATGGAGGGTGGAGGG + Intronic
1194937759 X:99971190-99971212 CTGTGGGGATGGGGGAGGGATGG + Intergenic
1194976890 X:100405559-100405581 GTGTGTGTATGGGGGGGGGAGGG - Intronic
1195272226 X:103243103-103243125 CTGTGTGTATGGTGGGAGTGTGG - Intergenic
1195423283 X:104699162-104699184 CTGTGGACTTGGTGGGGGGATGG + Intronic
1195828916 X:109033567-109033589 TTGTGGGTATGGGGGATGGGTGG + Intergenic
1196929545 X:120667763-120667785 CTGTGGGTCTGCTGGGTCTATGG + Intergenic
1196976105 X:121159377-121159399 TTGTGGGCATTCTGGGTGGAGGG + Intergenic
1197986716 X:132273840-132273862 TAATGGGTATGGGGGGTGGATGG - Intergenic
1198566961 X:137914854-137914876 ATGTGGGTAGGGTGAGGGGAGGG + Intergenic
1198618676 X:138483443-138483465 CAGGGTGTATGCTGGGTGGAAGG + Intergenic
1199086410 X:143634527-143634549 CTTGGGGTATGGTGGGGGGGGGG + Intronic
1199350174 X:146790817-146790839 TTGTGGGCTGGGTGGGTGGAAGG - Intergenic
1199487388 X:148362841-148362863 CTGTAGATGTGGTGGGTGGAGGG + Intergenic
1199714598 X:150497613-150497635 CGTGTGGTATGGTGGGTGGAGGG - Intronic
1200229845 X:154438401-154438423 CAGTGGGGATGGTGGGTGGAAGG + Intronic
1200303918 X:155006330-155006352 CTCTGGTTCTGGTGGCTGGAGGG - Intronic
1200317468 X:155148576-155148598 CTCTGGTTCTGGTGGCTGGAGGG + Intergenic