ID: 1037500430

View in Genome Browser
Species Human (GRCh38)
Location 8:19480339-19480361
Sequence TGCGTGTTCTCACCAATAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 15419
Summary {0: 1, 1: 3, 2: 203, 3: 4161, 4: 11051}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037500430_1037500432 19 Left 1037500430 8:19480339-19480361 CCACTTATTGGTGAGAACACGCA 0: 1
1: 3
2: 203
3: 4161
4: 11051
Right 1037500432 8:19480381-19480403 TGCATTAGTTTGCTTAGAGCTGG No data
1037500430_1037500433 24 Left 1037500430 8:19480339-19480361 CCACTTATTGGTGAGAACACGCA 0: 1
1: 3
2: 203
3: 4161
4: 11051
Right 1037500433 8:19480386-19480408 TAGTTTGCTTAGAGCTGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037500430 Original CRISPR TGCGTGTTCTCACCAATAAG TGG (reversed) Intronic
Too many off-targets to display for this crispr