ID: 1037500433

View in Genome Browser
Species Human (GRCh38)
Location 8:19480386-19480408
Sequence TAGTTTGCTTAGAGCTGGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037500430_1037500433 24 Left 1037500430 8:19480339-19480361 CCACTTATTGGTGAGAACACGCA 0: 1
1: 3
2: 203
3: 4161
4: 11051
Right 1037500433 8:19480386-19480408 TAGTTTGCTTAGAGCTGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037500433 Original CRISPR TAGTTTGCTTAGAGCTGGAG TGG Intronic
No off target data available for this crispr