ID: 1037501145

View in Genome Browser
Species Human (GRCh38)
Location 8:19486531-19486553
Sequence TCTGGGCAGGAATGCTTCGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 98}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037501145_1037501150 7 Left 1037501145 8:19486531-19486553 CCCTCGAAGCATTCCTGCCCAGA 0: 1
1: 0
2: 1
3: 3
4: 98
Right 1037501150 8:19486561-19486583 CACTAGCTGTTCCTTCCATCTGG No data
1037501145_1037501153 25 Left 1037501145 8:19486531-19486553 CCCTCGAAGCATTCCTGCCCAGA 0: 1
1: 0
2: 1
3: 3
4: 98
Right 1037501153 8:19486579-19486601 TCTGGAAACTCTCTTCCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037501145 Original CRISPR TCTGGGCAGGAATGCTTCGA GGG (reversed) Intronic
900434083 1:2619149-2619171 TCTGCGCAGGAATGCTTGCTGGG + Intronic
906456498 1:46001732-46001754 GGTGGGGAGGAGTGCTTCGAAGG + Intronic
907826485 1:58021982-58022004 TCTGGGAAGGATGGCTTCTAAGG + Intronic
921145013 1:212346386-212346408 TCTGGGGAGGATTGATTCCAGGG + Intronic
924665724 1:246069842-246069864 TCTTCCCAGGAATGCTTAGATGG + Intronic
1064608711 10:17074007-17074029 TATGAGCAGGAATTATTCGATGG + Intronic
1073680894 10:105702248-105702270 TATGGGCATGAATGCCTCTATGG + Intergenic
1075304828 10:121358552-121358574 TCAGCTCAGGAATGTTTCGAGGG + Intergenic
1076073978 10:127517519-127517541 TTTTGGCAAGAATGCTTCAAAGG - Intergenic
1077192274 11:1260443-1260465 TCTGGGCAGGAATGGATGGGTGG - Intronic
1083694984 11:64436741-64436763 TCTGGGCAGGAATGTTGCGAAGG + Intergenic
1084113123 11:67026116-67026138 TATGAGCAGGGATGCTTCCAGGG + Intronic
1096550346 12:52367979-52368001 TCTAGGCAGCATTGCTTGGAAGG + Intergenic
1097022172 12:56028107-56028129 TCTGGGCAGCAAGGCTTCATGGG + Intronic
1097316071 12:58172800-58172822 TCTGGTCATGAATGCTTCTGAGG + Intergenic
1099939489 12:89168471-89168493 CCTGGGCAGGAAGTCTTAGAAGG + Intergenic
1105302681 13:19150327-19150349 GCTCAGCAGGAATGCTGCGAGGG - Intergenic
1105542444 13:21326990-21327012 GCTGGTCAGGAATGCTGGGAGGG + Intergenic
1108416234 13:50200592-50200614 TCTGGGCCTTAATGCTTGGAAGG + Intronic
1117666243 14:58059303-58059325 TCTGGGAAGGCATGCTCCCAGGG + Intronic
1121407694 14:93728937-93728959 CCTGGGCTGGAATGCTTCTTTGG - Intronic
1123112876 14:105881273-105881295 TCTGGGCAGGATGGCCTCAATGG + Intergenic
1123121704 14:105919740-105919762 TCTGGGCAGGTCAGCTTCAACGG + Intronic
1124065475 15:26339881-26339903 TCGAGGCAGGAATTCTGCGAAGG + Intergenic
1126296090 15:47136569-47136591 TCTAGGCAGGAATGCTTTCTTGG - Intergenic
1136267266 16:29129071-29129093 TCTGGGCAGGAACCTCTCGATGG - Intergenic
1137026071 16:35476345-35476367 TCTGCTCAGGAATGTTTCCAAGG + Intergenic
1139714644 16:68802998-68803020 TCTTGGCAGGAATGTTTCTAGGG + Intronic
1145835524 17:27951813-27951835 TCTGGGCAGGATGGCTCCCAAGG + Intergenic
1146126974 17:30237851-30237873 GCTGGGCAGGAATGCATCTTCGG - Intergenic
1146892048 17:36512571-36512593 TCGGGGCAGGAGTGCTTTGGGGG - Intronic
1148778087 17:50106930-50106952 TCTGGCCAGGTAAGCTTGGAGGG - Intronic
1151736683 17:75946327-75946349 ACTGAGCAGGAAAGCTTGGAAGG + Exonic
1152145418 17:78565595-78565617 TCTGGGCTTGACTGCTTCCAGGG - Intronic
1152244855 17:79179966-79179988 AGTGGGCAGGAAAGCTTCAAAGG + Intronic
1160906129 19:1452509-1452531 TCTGGGCAGGCTTGCTTTTATGG + Exonic
1162354498 19:10173359-10173381 TCTTGGAAGGAATGAATCGAGGG - Intronic
1164669165 19:30063200-30063222 TCTGGGCAGGGATGGTCTGAAGG - Intergenic
1166324817 19:42042691-42042713 TCGGGGAACGAACGCTTCGAGGG - Exonic
928374833 2:30765749-30765771 CCCGGGCACGAATGCTTAGAAGG + Intronic
928674009 2:33632607-33632629 CCAGGGCAGGAATCCTTTGAAGG + Intergenic
928892451 2:36219516-36219538 TCTCAGCAGTAATGCCTCGAAGG - Intergenic
930225725 2:48790578-48790600 CCAGAGCAGGAAGGCTTCGATGG + Intergenic
932185148 2:69688287-69688309 TTTGGGAAGGAATGCTTTGTTGG + Intronic
936707848 2:115097361-115097383 TCTTTGCTGGAATGCTTCAAAGG + Intronic
938117290 2:128610639-128610661 TCTGGGCAGGAGTGTTTCTGTGG - Intergenic
944362721 2:198877312-198877334 TCTGAGCAGGAACGCTTGGCTGG + Intergenic
947243035 2:228017291-228017313 TCTGTGCTGGACTGCTTAGAGGG + Exonic
1169744926 20:8933944-8933966 TCGGGGCAGGAATCTTTTGATGG - Intronic
1169921000 20:10734067-10734089 TCTGGGCAGAAAAGATTAGATGG - Intergenic
1169923400 20:10758496-10758518 ACTGGTCAGGGATGCTTCCAGGG - Intergenic
1179136378 21:38683585-38683607 CTGGGGCAGGTATGCTTCGAAGG + Intergenic
1182624377 22:31635260-31635282 TCTGGGCTGGAAGGAATCGAGGG - Intronic
1184389475 22:44195021-44195043 TGTGGGCAGGGATGCTATGAGGG + Intronic
1184721704 22:46318383-46318405 TCTGTGCTGGAATGCTTTGGGGG + Intronic
1184932442 22:47691351-47691373 TCTGGGCAGGAATGCCGGGCTGG - Intergenic
953386840 3:42511404-42511426 TGTGGCCAGGAATGCTCTGATGG + Intronic
954441386 3:50524124-50524146 TCTGGGCAGGAATACCCAGAGGG - Intergenic
961563666 3:127748185-127748207 TCTGGGTAGGCATGCTTTTATGG - Intronic
961951256 3:130751807-130751829 TCTTGGCAAGAATGCTTCCTGGG - Intergenic
966237163 3:177714696-177714718 TCCTGGCAGGAATGCTGAGATGG - Intergenic
969864942 4:10069211-10069233 TCTGGGAAGGAAAGCTGAGAAGG - Intergenic
971822424 4:31575523-31575545 TCAGGGCAGTATTGCTTCTAGGG + Intergenic
973745341 4:53958580-53958602 TCAGGGCAGAAATGCGTTGATGG + Intronic
974261102 4:59525004-59525026 TCTTGGGAGGAATGCTTTGAAGG + Intergenic
974572523 4:63671511-63671533 TCTGGTGAGGGTTGCTTCGAAGG + Intergenic
978213518 4:106168403-106168425 TCTTAGCAGGAAGGCTTCTAGGG - Intronic
984961176 4:185100094-185100116 TCTGGGGAGGACTGCCTCGTGGG + Intergenic
984961184 4:185100119-185100141 TCTGGGGAGGACTGCCTCGTGGG + Intergenic
985619013 5:943752-943774 TCTGGTCAGGATGGCTTTGATGG - Intergenic
991408879 5:66327621-66327643 TCAGGAGAGGAATGGTTCGATGG + Intergenic
992146906 5:73859803-73859825 TGTGGCCAGGGATGCATCGAAGG - Intronic
997588469 5:135058520-135058542 TCTGTGCAGGAATCCTTTTAAGG + Intronic
998590574 5:143473419-143473441 TCTGGACAGAAACGCTTAGATGG - Intergenic
998918775 5:147044332-147044354 TCTGGTCAGGAATGTTGTGAGGG + Intronic
1003409576 6:5850831-5850853 GCTGGTCAGGAATGCTCCGGGGG - Intergenic
1004419246 6:15453406-15453428 TCTTGGCAGGAATGCCACAAGGG + Intronic
1006753073 6:36391505-36391527 TCTGGGCAGCAAGGCTTCCTGGG + Exonic
1007922853 6:45626456-45626478 TCTGGGCAGGAAGTCTTACATGG - Intronic
1011747060 6:90416486-90416508 TCTGGGCAGTGATGCTTTGCTGG + Intergenic
1011791172 6:90900627-90900649 TCTGGGTTGGAATGCCTGGATGG + Intergenic
1015031767 6:128603858-128603880 TCTGGGCAGGAATGGGTCTTGGG + Intergenic
1019540972 7:1550816-1550838 TCTGTGCGGGACTGCTACGAAGG - Exonic
1020733321 7:11912253-11912275 TCTGGGCAGGATTGATACAAAGG + Intergenic
1023430746 7:40088328-40088350 CCTGGTCAGTAATGCTTCCATGG + Exonic
1024283763 7:47739605-47739627 TCAGGGCAGGCAAGCTTCAAGGG - Intronic
1025720428 7:64006398-64006420 TCTGGGGAGCTGTGCTTCGATGG + Intergenic
1027363264 7:77431180-77431202 TCTGGGCAGGAGAGCTTTCATGG - Intergenic
1032844898 7:135744097-135744119 TCTAGGCAAGAAAGCTTTGAAGG - Intronic
1034971991 7:155424978-155425000 TTTAGGCAGGATTGGTTCGAAGG - Intergenic
1036562198 8:9906744-9906766 TCTGGGCAGGACAGCTGCGGGGG + Intergenic
1037501145 8:19486531-19486553 TCTGGGCAGGAATGCTTCGAGGG - Intronic
1038199586 8:25399845-25399867 TCTGTGCAGGAAAGCCTGGAAGG - Intronic
1047950101 8:129925436-129925458 TCTGTTCAGGAATGCTTTCAGGG + Intronic
1051674966 9:19549640-19549662 CCTGGGCAGAAATGATTCAAAGG - Intronic
1053256817 9:36624543-36624565 TCTGGATAGGATTGCTTCCATGG + Intronic
1056151287 9:83791710-83791732 ACTGGGTAGGAATTCTTCAAGGG - Intronic
1057477534 9:95415563-95415585 TCTGGCCAGGAATGCTGCTGGGG - Intergenic
1060421477 9:123472581-123472603 CCAGGGCAGGACTGCATCGAGGG + Intronic
1185975741 X:4718385-4718407 TCTGTGCAGGAACGCTTCGTGGG - Intergenic
1186514547 X:10156826-10156848 TCTGGACACGAATGCTCCGGGGG + Intergenic
1197848739 X:130833723-130833745 TCAGGGCAAGAATGGTTTGAGGG - Intronic
1200643028 Y:5746570-5746592 TCTGGGCAGCCCTGCTTCTATGG + Intergenic