ID: 1037501146

View in Genome Browser
Species Human (GRCh38)
Location 8:19486532-19486554
Sequence CTCTGGGCAGGAATGCTTCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 120}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037501146_1037501153 24 Left 1037501146 8:19486532-19486554 CCTCGAAGCATTCCTGCCCAGAG 0: 1
1: 0
2: 0
3: 13
4: 120
Right 1037501153 8:19486579-19486601 TCTGGAAACTCTCTTCCTTCAGG No data
1037501146_1037501154 30 Left 1037501146 8:19486532-19486554 CCTCGAAGCATTCCTGCCCAGAG 0: 1
1: 0
2: 0
3: 13
4: 120
Right 1037501154 8:19486585-19486607 AACTCTCTTCCTTCAGGTATAGG No data
1037501146_1037501150 6 Left 1037501146 8:19486532-19486554 CCTCGAAGCATTCCTGCCCAGAG 0: 1
1: 0
2: 0
3: 13
4: 120
Right 1037501150 8:19486561-19486583 CACTAGCTGTTCCTTCCATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037501146 Original CRISPR CTCTGGGCAGGAATGCTTCG AGG (reversed) Intronic
900434082 1:2619148-2619170 ATCTGCGCAGGAATGCTTGCTGG + Intronic
901098714 1:6702629-6702651 TTCTGGGCAGGAAGGCTTCTGGG - Intergenic
902975257 1:20083721-20083743 CTCTGGGAAGGGAGGCTGCGTGG + Intronic
903953182 1:27008239-27008261 CTCAGGACAGGAATGCTGCCTGG - Intronic
904354927 1:29932843-29932865 CTCTGGGAAGGGAGGCTTGGTGG - Intergenic
908476499 1:64493893-64493915 CTCTGTGAAAGAATGCTTTGTGG + Intronic
913210815 1:116580886-116580908 CTCTAGGGAAGAATGCTTCCTGG - Intronic
915040344 1:152963104-152963126 CTCTGGCCAGGAAACCTTCTGGG - Intergenic
919768270 1:201141093-201141115 GTCTGGGAAGGAAGGCTTCCTGG - Intronic
922240981 1:223755427-223755449 CCCTGAGCAGGAATGCATGGGGG - Intronic
922433453 1:225580138-225580160 CTCTGGGCATGAATACTAGGAGG - Intronic
922549751 1:226485274-226485296 CTCTGGGCAGGAAGCCTGTGAGG + Intergenic
924397362 1:243636514-243636536 CTCTGGACAGGAATATTTTGAGG - Intronic
1062848440 10:725706-725728 CTCTGGGCAGGGCTGCTGCCTGG - Intergenic
1065130136 10:22612378-22612400 CCCTGGGCAGCAATGGCTCGTGG + Intronic
1067877534 10:50019112-50019134 CTTTGGGCAGGGGTGATTCGGGG - Intergenic
1070676388 10:78414547-78414569 CTTTTGGCAAGAATCCTTCGTGG + Intergenic
1073307409 10:102514303-102514325 CTCCTGGCAGGCATGCTTCAGGG + Intronic
1073351023 10:102819882-102819904 CTCTGTGCACACATGCTTCGTGG - Intergenic
1076014258 10:127015224-127015246 CTCAGGGTAGGACTGCTTCTTGG - Intronic
1077409103 11:2395298-2395320 CCCTGGGCAGGGTGGCTTCGAGG - Intronic
1080318807 11:30981819-30981841 ATCTGGGCTGGAATGCTGCATGG + Intronic
1084928930 11:72538257-72538279 CTCTTGGAATGAATGCTTCTAGG - Intergenic
1085935187 11:81133279-81133301 CTCTTGCCGGGAATGCTTAGTGG + Intergenic
1086099911 11:83088359-83088381 CTCTGGGCAGGAAAACTAAGGGG + Intergenic
1089431007 11:118424503-118424525 CTCTTGGTAGGTATGCTTTGTGG - Intronic
1089496651 11:118911435-118911457 CTCTGGGGAGGAAGGCTCCTGGG + Intronic
1090737490 11:129622889-129622911 CTCTGGGCAGGGAAGCTGGGAGG + Intergenic
1090889891 11:130914602-130914624 CTCTGGGCAGGAATTCAGTGTGG + Exonic
1097022171 12:56028106-56028128 CTCTGGGCAGCAAGGCTTCATGG + Intronic
1097052669 12:56232717-56232739 GTCTGGGCAGGGATGCCTCTGGG + Exonic
1097182255 12:57178211-57178233 CTCTGGCCAGCAAGGCTTAGGGG + Intronic
1101950269 12:109169268-109169290 CTTGGGGCAGGAAGGCTTAGGGG - Intronic
1102932756 12:116875249-116875271 CTCTGGGCGGGAGTGGTTCCAGG - Intronic
1104573068 12:129942329-129942351 CTCTGGGCTGGAATTGTTCCTGG - Intergenic
1107037577 13:35917415-35917437 CTGTGGTCAGTGATGCTTCGGGG + Intronic
1113644140 13:111980413-111980435 CTCTGGGCAGTAATGCCCAGGGG + Intergenic
1119807317 14:77490787-77490809 CTCTGGGCAGCCAAGCTTCCAGG + Intronic
1120787421 14:88550267-88550289 CACTGGCCAGGAAAGCCTCGAGG - Exonic
1122902534 14:104787739-104787761 CTCTGGGCAGGGATGCCCTGTGG - Intronic
1124800055 15:32823813-32823835 CCCTGGTCCAGAATGCTTCGTGG + Intronic
1126752495 15:51891425-51891447 CTTTTGGCAAGAATGCTTCATGG + Intronic
1129252100 15:74314738-74314760 CTCCTGGCAGGAATGCTGCTGGG - Intronic
1132350799 15:101138733-101138755 GTCTGGGCAGGAACGGTTTGAGG - Intergenic
1135869570 16:26136919-26136941 CTCTTGGAAAGAAGGCTTCGAGG - Exonic
1139714643 16:68802997-68803019 TTCTTGGCAGGAATGTTTCTAGG + Intronic
1140067454 16:71623916-71623938 CTCTGGGAAGAAAGGCTTCAGGG + Intergenic
1140960005 16:79902632-79902654 CTCTGGACAAGAAAACTTCGAGG + Intergenic
1141446751 16:84064260-84064282 CTCTGTGCAGGAATCCTACTAGG + Intronic
1142782557 17:2192469-2192491 CTCTGGGCTGGAATGGCTCGTGG - Intronic
1146892049 17:36512572-36512594 GTCGGGGCAGGAGTGCTTTGGGG - Intronic
1147251839 17:39157329-39157351 CTCTGGGCAAGGATTCTTCACGG + Intronic
1148063538 17:44852641-44852663 CTCTGGGCTGGAATGCATTTGGG - Intronic
1148778088 17:50106931-50106953 CTCTGGCCAGGTAAGCTTGGAGG - Intronic
1154293606 18:13131325-13131347 CTCTGGGCACCAAGGCTTTGGGG - Intergenic
1156456799 18:37299394-37299416 CTCTGGGCAGGGATGCTCCTGGG + Intronic
1157200350 18:45654121-45654143 CTTTTGGCAGGAATGCTGGGGGG + Intronic
1158665585 18:59429805-59429827 CTCTGGGAAGGAGCGCATCGTGG + Intergenic
1166812169 19:45521220-45521242 CTCTGGGCAGGATTCCTGGGAGG + Intronic
1167020680 19:46873079-46873101 CTCTGGGCCAGACTGCTTTGGGG - Intergenic
925870392 2:8265147-8265169 CTCCTGGCAGGGATGTTTCGTGG - Intergenic
927647590 2:24887666-24887688 CTCGGGGCAGGAAAGCATGGCGG + Intronic
932284092 2:70518183-70518205 CTCGGGACAGGAAGGCTTCTAGG + Intronic
933832525 2:86222449-86222471 CTCTTGGCAGAAATGCTCAGCGG - Intronic
937609333 2:123840985-123841007 CTCTGCACAGGAATGCTGTGGGG - Intergenic
941375084 2:164718569-164718591 CTCTGGGCAGGAGAACTTGGTGG + Intronic
944624790 2:201559519-201559541 CTCTGGGCAGGAATACTCCCAGG + Intronic
947243034 2:228017290-228017312 CTCTGTGCTGGACTGCTTAGAGG + Exonic
1169923401 20:10758497-10758519 CACTGGTCAGGGATGCTTCCAGG - Intergenic
1173259282 20:41419066-41419088 CACATGGCAGCAATGCTTCGTGG + Intronic
1174416872 20:50373228-50373250 CACAGGGCAGGATTGTTTCGGGG - Intergenic
1179601372 21:42479874-42479896 CTCTGAGCACGAATTCTTCATGG - Intronic
1182971256 22:34580464-34580486 CTCTGAGTAGGAGTGCTTAGGGG - Intergenic
1184486842 22:44784965-44784987 CTCTGTGCAGGAATGGGGCGGGG - Intronic
1184721703 22:46318382-46318404 CTCTGTGCTGGAATGCTTTGGGG + Intronic
1185329533 22:50245947-50245969 CTCCTGGCTGCAATGCTTCGGGG - Exonic
952966755 3:38625786-38625808 GGCTGGGCAGGAAGGCTTCCTGG + Intronic
955341953 3:58131713-58131735 CTCAGGGCAGAAATGGTTTGGGG + Intronic
955346004 3:58162298-58162320 CCCTGGGCAGGAGGGCTTCAAGG + Intronic
961116030 3:124330798-124330820 CTCTGGGCAGGATTAGTTAGAGG + Intronic
961951257 3:130751808-130751830 TTCTTGGCAAGAATGCTTCCTGG - Intergenic
962456107 3:135567141-135567163 CCATGGGCAGGAAGGATTCGAGG - Intergenic
963854351 3:150238516-150238538 CTCTGGGCAGAAATGCACCAGGG + Intergenic
970057912 4:11996211-11996233 CTCAGGGCCAGAAGGCTTCGTGG + Intergenic
971822423 4:31575522-31575544 CTCAGGGCAGTATTGCTTCTAGG + Intergenic
975520820 4:75299321-75299343 CTCTTGGCAGAAATGCTACAAGG - Intergenic
976398400 4:84582482-84582504 CACTGGGCTGGAATGCCGCGGGG + Intergenic
979896366 4:126162952-126162974 CTCTGGGCAGGGATAATACGTGG - Intergenic
984575573 4:181444188-181444210 CTATGGGCAGGAATCCTTCCAGG + Intergenic
984856311 4:184199044-184199066 CTCTGGTCACATATGCTTCGTGG - Intronic
984961159 4:185100043-185100065 CTCTGGGGAGGACAGCCTCGTGG + Intergenic
984961167 4:185100068-185100090 CTCTGGGGAGGACAGCCTCGTGG + Intergenic
984961175 4:185100093-185100115 CTCTGGGGAGGACTGCCTCGTGG + Intergenic
984961183 4:185100118-185100140 CTCTGGGGAGGACTGCCTCGTGG + Intergenic
986847799 5:11776022-11776044 CTCTAGGAAAGAATCCTTCGTGG - Intronic
991487708 5:67155353-67155375 CTCATGGCAGGAAAGCTTTGAGG - Intronic
997700216 5:135892569-135892591 CTCTTGGCAGGTAGGCTTCTGGG - Intronic
999113487 5:149141754-149141776 CGCTGGGCAGGAATAGTCCGGGG + Exonic
1003409577 6:5850832-5850854 AGCTGGTCAGGAATGCTCCGGGG - Intergenic
1004193779 6:13486880-13486902 CTCTGAGCAGCCATGCTTCCCGG - Exonic
1004359262 6:14956457-14956479 CTCTGGGAAGGATGGCTTTGGGG + Intergenic
1005938999 6:30546925-30546947 CTCTGGCCTGGAATGTTTTGGGG - Intronic
1006753072 6:36391504-36391526 TTCTGGGCAGCAAGGCTTCCTGG + Exonic
1007134831 6:39510511-39510533 CTCTGGTAAGGAAGGCTTGGTGG - Intronic
1007266080 6:40596993-40597015 ACCTGGGAAGGAATGCTTGGTGG - Intergenic
1015031766 6:128603857-128603879 CTCTGGGCAGGAATGGGTCTTGG + Intergenic
1015422750 6:133029973-133029995 CTATGGGCAGGAATTCTCCCAGG - Intergenic
1016456338 6:144234774-144234796 CTCTGGGCACTAAGGCTTGGGGG + Intergenic
1018664044 6:166117760-166117782 GTGTGGGAAGGAATGCTTCTAGG - Intergenic
1019412131 7:911332-911354 CTCTGGGCAGGAAGGCGCTGTGG - Intronic
1024283764 7:47739606-47739628 CTCAGGGCAGGCAAGCTTCAAGG - Intronic
1034468823 7:151245296-151245318 CTCTGGGGAGGTAGGCTTAGGGG - Intronic
1036562197 8:9906743-9906765 GTCTGGGCAGGACAGCTGCGGGG + Intergenic
1037501146 8:19486532-19486554 CTCTGGGCAGGAATGCTTCGAGG - Intronic
1037688089 8:21160945-21160967 GGCTGGGCAGGGATGCTGCGGGG - Intergenic
1038192377 8:25335031-25335053 CTCTGGGGAGGAATGCGGAGTGG - Intronic
1040060573 8:43100061-43100083 CACAGGGCAGGAGTCCTTCGGGG + Intronic
1042390417 8:68227855-68227877 CTCTGGGGAGGGATGTTTCTTGG + Intronic
1052441825 9:28507401-28507423 CACTGAGCATGAATGCTTTGAGG - Intronic
1052995173 9:34548053-34548075 CACTAGGCAGGAATCCTTCCTGG - Intergenic
1053179968 9:35960437-35960459 CTGTGGGCATGAATGATGCGTGG + Intergenic
1056726510 9:89123705-89123727 CTCTGGCCAGGAAAGTTTGGTGG - Intronic
1057477535 9:95415564-95415586 ATCTGGCCAGGAATGCTGCTGGG - Intergenic
1057533989 9:95880341-95880363 CTCTGGACAGCAATGCTTTGTGG - Intronic
1060302512 9:122383569-122383591 CTCTGGGGCGGGATGCCTCGGGG - Exonic
1185975742 X:4718386-4718408 GTCTGTGCAGGAACGCTTCGTGG - Intergenic
1185980516 X:4773358-4773380 CTTTGGGCAGGAATTATTCCAGG + Intergenic
1186514546 X:10156825-10156847 CTCTGGACACGAATGCTCCGGGG + Intergenic
1189103002 X:38210453-38210475 CTCTGGGAAGCAGTGCTTCATGG + Intronic
1195796517 X:108654413-108654435 CTTTGCCCAGGAATGCTTCATGG + Intronic
1197848740 X:130833724-130833746 CTCAGGGCAAGAATGGTTTGAGG - Intronic
1201748956 Y:17411868-17411890 CTGTGGGCTGGATTGCTTCTGGG - Intergenic
1201852620 Y:18503332-18503354 GTCTGGGCAGGAATGTTTTTTGG - Intergenic
1201880701 Y:18817052-18817074 GTCTGGGCAGGAATGTTTTTTGG + Intronic