ID: 1037501150

View in Genome Browser
Species Human (GRCh38)
Location 8:19486561-19486583
Sequence CACTAGCTGTTCCTTCCATC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037501148_1037501150 -10 Left 1037501148 8:19486548-19486570 CCCAGAGCTTGCACACTAGCTGT 0: 1
1: 0
2: 0
3: 11
4: 124
Right 1037501150 8:19486561-19486583 CACTAGCTGTTCCTTCCATCTGG No data
1037501145_1037501150 7 Left 1037501145 8:19486531-19486553 CCCTCGAAGCATTCCTGCCCAGA 0: 1
1: 0
2: 1
3: 3
4: 98
Right 1037501150 8:19486561-19486583 CACTAGCTGTTCCTTCCATCTGG No data
1037501143_1037501150 19 Left 1037501143 8:19486519-19486541 CCTGCACACTGCCCCTCGAAGCA 0: 1
1: 0
2: 0
3: 13
4: 104
Right 1037501150 8:19486561-19486583 CACTAGCTGTTCCTTCCATCTGG No data
1037501142_1037501150 20 Left 1037501142 8:19486518-19486540 CCCTGCACACTGCCCCTCGAAGC 0: 1
1: 0
2: 1
3: 11
4: 122
Right 1037501150 8:19486561-19486583 CACTAGCTGTTCCTTCCATCTGG No data
1037501144_1037501150 8 Left 1037501144 8:19486530-19486552 CCCCTCGAAGCATTCCTGCCCAG 0: 1
1: 0
2: 0
3: 9
4: 101
Right 1037501150 8:19486561-19486583 CACTAGCTGTTCCTTCCATCTGG No data
1037501147_1037501150 -6 Left 1037501147 8:19486544-19486566 CCTGCCCAGAGCTTGCACACTAG 0: 1
1: 0
2: 1
3: 18
4: 176
Right 1037501150 8:19486561-19486583 CACTAGCTGTTCCTTCCATCTGG No data
1037501146_1037501150 6 Left 1037501146 8:19486532-19486554 CCTCGAAGCATTCCTGCCCAGAG 0: 1
1: 0
2: 0
3: 13
4: 120
Right 1037501150 8:19486561-19486583 CACTAGCTGTTCCTTCCATCTGG No data
1037501141_1037501150 21 Left 1037501141 8:19486517-19486539 CCCCTGCACACTGCCCCTCGAAG 0: 1
1: 0
2: 3
3: 18
4: 230
Right 1037501150 8:19486561-19486583 CACTAGCTGTTCCTTCCATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037501150 Original CRISPR CACTAGCTGTTCCTTCCATC TGG Intronic
No off target data available for this crispr