ID: 1037503279

View in Genome Browser
Species Human (GRCh38)
Location 8:19505777-19505799
Sequence TTCCCGGGTGGTGGTTTTGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 117}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037503279_1037503290 17 Left 1037503279 8:19505777-19505799 CCAGCAAAACCACCACCCGGGAA 0: 1
1: 0
2: 1
3: 17
4: 117
Right 1037503290 8:19505817-19505839 CCGGCGAACCATCATCATTCAGG 0: 1
1: 0
2: 0
3: 1
4: 25
1037503279_1037503284 -2 Left 1037503279 8:19505777-19505799 CCAGCAAAACCACCACCCGGGAA 0: 1
1: 0
2: 1
3: 17
4: 117
Right 1037503284 8:19505798-19505820 AAATCCACGCAAGCAGCCCCCGG 0: 1
1: 0
2: 0
3: 6
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037503279 Original CRISPR TTCCCGGGTGGTGGTTTTGC TGG (reversed) Exonic
903204260 1:21768739-21768761 TACACGGGTGGTGGGTATGCTGG - Intronic
905733685 1:40312463-40312485 TTCCAGGGCCCTGGTTTTGCTGG - Exonic
908739045 1:67308202-67308224 GTACTGGGTGGTGGTTTGGCTGG + Intronic
910405059 1:86880055-86880077 TTGCCGGGTGGGAATTTTGCAGG - Intronic
915505433 1:156352971-156352993 TACTGGGATGGTGGTTTTGCTGG - Intronic
917495788 1:175538926-175538948 TTCCCAAGTGGTGGATTTTCAGG + Intronic
918171816 1:182004568-182004590 TTCTCGAATGCTGGTTTTGCTGG - Intergenic
918298280 1:183178588-183178610 TTCCTGGGTGGTTCTTTTGCAGG - Intergenic
918753664 1:188307432-188307454 TTCCTGTGTGGTGATTTTACTGG + Intergenic
919978963 1:202630590-202630612 TTCCAGGGTGGTGGCTGTGAGGG - Intronic
920384909 1:205564223-205564245 TCCCTGTGTGGTTGTTTTGCTGG - Intergenic
1063622268 10:7660442-7660464 TTTCCTGGTGGTGATGTTGCTGG - Intronic
1066758216 10:38730911-38730933 TTCCCGGGTGGGGTTTGTGAGGG + Intergenic
1067420837 10:46145355-46145377 TTCCCAGGTGGTTGCTTTGTGGG - Intergenic
1067506176 10:46851822-46851844 TTCCCAGGTGGTTGCTTTGTGGG - Intergenic
1069929619 10:71873735-71873757 TTCTAGGGCTGTGGTTTTGCAGG - Intergenic
1070891268 10:79943682-79943704 TTTCCAGGTGGTGGTGCTGCTGG - Intronic
1071237000 10:83660730-83660752 TTCCCATGTTGTGGTTTTCCAGG - Intergenic
1076351220 10:129816285-129816307 TCCCCGGGTGGTGGCGTTGCAGG + Intergenic
1076786955 10:132754685-132754707 TGCCTGGGTGGTGGTGTTTCAGG - Intronic
1084978246 11:72814839-72814861 TCCTCGGGTGTTGGTTTTGCAGG + Intronic
1087768576 11:102182153-102182175 TTCCCAGGTGGTGCTGATGCCGG - Intronic
1088132081 11:106505258-106505280 TTCCCAGTTGCTGGTTTTGTTGG + Intergenic
1089018154 11:115183980-115184002 TTCCTGGGTGGAGATCTTGCTGG + Intronic
1093147362 12:15582341-15582363 TTCCCTGGTGGTGGTGGTGTAGG - Intronic
1093323530 12:17743992-17744014 TCCCAGGGTGGTGGGATTGCAGG - Intergenic
1097777041 12:63658973-63658995 TTGACTGGTGATGGTTTTGCAGG + Intronic
1101435815 12:104663422-104663444 TCTCTGGGTGGTGGATTTGCTGG - Intronic
1102107225 12:110335842-110335864 TTCCTGGGTGGTGGTTTGTGGGG - Intronic
1104198157 12:126561343-126561365 TGCCCGGGTGGTGGATGTGTGGG - Intergenic
1106050053 13:26181179-26181201 TTCCCTGGTGCTGCTTTTCCTGG - Intronic
1106349934 13:28920828-28920850 CTCCCTTGTGGTGGTGTTGCTGG - Intronic
1106410262 13:29506390-29506412 GTTCCCTGTGGTGGTTTTGCAGG + Intergenic
1110205438 13:72906791-72906813 TCTTCGTGTGGTGGTTTTGCAGG + Intronic
1114903106 14:27090458-27090480 TTCCATGGTGCTTGTTTTGCAGG + Intergenic
1115510564 14:34133927-34133949 TTCCCTGCTGGTGGGTTAGCTGG + Intronic
1118073091 14:62267725-62267747 TTCCAGGGTGTGGCTTTTGCAGG + Intergenic
1120912593 14:89681144-89681166 TTCCTACGTGGTGGTTTTGCAGG - Intergenic
1121216460 14:92252216-92252238 ACCCCGGGTGGTGGTCCTGCTGG + Intergenic
1122886866 14:104714088-104714110 TTCTGGGGAGGAGGTTTTGCAGG + Intronic
1123043356 14:105499540-105499562 TTCCCGGGAGGTGGTGCTCCGGG + Intronic
1123734906 15:23175856-23175878 TCCCAGGGTGGTGGGGTTGCAGG - Intergenic
1123734936 15:23175993-23176015 TCCCGGGGTGGTGGGATTGCAGG - Intergenic
1124285411 15:28397160-28397182 TCCCAGGGTGGTGGGGTTGCAGG - Intergenic
1124285441 15:28397297-28397319 TCCCGGGGTGGTGGGATTGCAGG - Intergenic
1124297256 15:28514345-28514367 TCCCGGGGTGGTGGGATTGCAGG + Intergenic
1124297286 15:28514482-28514504 TCCCAGGGTGGTGGGGTTGCAGG + Intergenic
1124494561 15:30178477-30178499 TTCCAGGGTGGTGGCTGTGAGGG - Intergenic
1124574455 15:30895758-30895780 TCCCCGGGTGTTGGGATTGCAGG - Intergenic
1124574544 15:30896212-30896234 TCCCCGGGTGCTGGAATTGCAGG - Intergenic
1124749009 15:32360168-32360190 TTCCAGGGTGGTGGCTGTGAGGG + Intergenic
1126655034 15:50967930-50967952 CTCCCGGGTGGTGGCTGTGCTGG + Intronic
1132251004 15:100335318-100335340 TTGTGGGGTGGTGGTTTTACGGG - Intronic
1133590152 16:7234378-7234400 TTCCCACTTTGTGGTTTTGCTGG - Intronic
1136512762 16:30748994-30749016 TTCGCGGGTGGTGGTGGTGGTGG + Intronic
1136997289 16:35199093-35199115 TGCAGGGGTGGTGTTTTTGCAGG - Intergenic
1138556367 16:57773221-57773243 TTCCTGTGTGGTGGTTTAGGAGG + Intronic
1139630210 16:68226758-68226780 TTCCGAGGTGCTGCTTTTGCAGG + Exonic
1144568834 17:16382161-16382183 TTCCAGGGTGATGGTCTTGCCGG - Exonic
1145360028 17:22204346-22204368 TTCCAGGGTGATGGTCTTGCCGG - Exonic
1145360063 17:22204574-22204596 TTCCAGGGTGATGGTCTTGCCGG - Exonic
1156818211 18:41338178-41338200 TTGCTGGGAGGTGGTCTTGCTGG + Intergenic
1160665377 19:325704-325726 TTCCCAGGTGCTTGCTTTGCAGG - Exonic
1160818993 19:1049419-1049441 TCACAGGGTGGTGGTCTTGCCGG - Exonic
1160824131 19:1071523-1071545 TTCCCGGGTAGGGGGTGTGCGGG + Intronic
1161063348 19:2226176-2226198 TTGCCAGGTGGTGGCTTGGCGGG + Exonic
1161993554 19:7698820-7698842 TTCCCAGGAGGCGGTGTTGCAGG - Exonic
926424258 2:12726977-12726999 TCCCCCACTGGTGGTTTTGCAGG + Intronic
926590768 2:14738045-14738067 TTCCCTGGTGGCAGTTTTACAGG + Intergenic
929570050 2:43017090-43017112 TGTTTGGGTGGTGGTTTTGCAGG - Intergenic
936869471 2:117117659-117117681 TTCCCAGATGGAGGTTTTGCCGG - Intergenic
938733778 2:134167522-134167544 TTCCCAGGTGATGATGTTGCCGG + Intronic
939989449 2:148863754-148863776 CTCCAGGGTGATGGTCTTGCCGG + Intergenic
940034169 2:149295906-149295928 TTCCCAGGTGATGGTGATGCTGG + Intergenic
942488271 2:176462303-176462325 TTGCTGGGTGGTTGTTTTTCTGG + Intergenic
945055844 2:205868380-205868402 ATCCCGGGTGGTGGTTGTGGGGG - Intergenic
948601106 2:239107954-239107976 ATTCAGGGTGTTGGTTTTGCAGG - Intronic
1171204348 20:23267342-23267364 TTCCTGGGTGGATGTTTGGCTGG + Intergenic
1174594641 20:51674241-51674263 TGCCCTGGTGGTGGTCTCGCTGG - Exonic
1175059863 20:56232120-56232142 TACCTGGATGGTGGTTTTGGAGG + Intergenic
1176302959 21:5107452-5107474 TTCCCTAGAGGTGGCTTTGCCGG + Intergenic
1179854066 21:44154472-44154494 TTCCCTAGAGGTGGCTTTGCCGG - Intergenic
1181106675 22:20579715-20579737 TGCTGGGGTGGTGGTGTTGCTGG + Intronic
1184975523 22:48058790-48058812 CTCCCTGCTGGTGCTTTTGCTGG - Intergenic
951196154 3:19826040-19826062 TACCTGGGTGGTGGTTATGCAGG - Intergenic
951548545 3:23853770-23853792 ATTCCTGGTGGTGGTTTTTCAGG + Intronic
952442795 3:33349927-33349949 GACCCGGATGGTGGTTTTACTGG + Intronic
952860853 3:37811193-37811215 TTCCTGCATGGTGGTTTGGCTGG - Intronic
954415504 3:50391363-50391385 CTCCCTGGTGGTGGTTTTGGTGG + Intronic
962092690 3:132261882-132261904 TTCCCTGGTGGTGGTGGTGGTGG - Intronic
967823653 3:193861347-193861369 GTCCTGGGTGGTGGCTGTGCAGG + Intergenic
968360105 3:198140735-198140757 TTCTCGGGTGGCCGTTTTGTGGG + Intergenic
969610429 4:8225025-8225047 TTGCAGGGTGCTGGTGTTGCGGG - Intronic
973289309 4:48454618-48454640 TTCCCAGCAGGTGATTTTGCTGG - Intergenic
980082214 4:128356372-128356394 TTCCCTGGACGTGGATTTGCTGG + Intergenic
982649939 4:158075457-158075479 TTCACGGATTGTGCTTTTGCTGG + Intergenic
984647542 4:182235379-182235401 TTCCCAGGCGGTGGTTCTTCAGG + Intronic
986130209 5:4923199-4923221 TTCACTGATGGTGGTTTTCCAGG - Intergenic
987411653 5:17620895-17620917 CTGCCAGGTGGTGGCTTTGCAGG + Intergenic
987416773 5:17670539-17670561 CTCCGAGGTGGTGGCTTTGCAGG + Intergenic
991134800 5:63168785-63168807 TTCCCCAGTGGTGGTGTTGCTGG - Intergenic
991651768 5:68862911-68862933 TTCCCAGGTGATGGTGTTCCAGG - Intergenic
992777909 5:80104464-80104486 TTACCAGGTGGTGGCTGTGCTGG + Intergenic
993003719 5:82408513-82408535 TTCTGGGGTGGTGGATATGCAGG - Intergenic
1003623144 6:7720098-7720120 TACCTGGGTGGTGGTTATACAGG - Intergenic
1004740828 6:18459033-18459055 GTGCTGGGTGGTGGTTTTGATGG + Intronic
1008000969 6:46359136-46359158 TTCCCAGCTGGTGCTGTTGCTGG + Intronic
1008708226 6:54190064-54190086 CTCCATGGTGGTTGTTTTGCAGG + Intronic
1011871528 6:91900348-91900370 TGCCCAGGTTGTGGTTTTGCTGG - Intergenic
1017422744 6:154289957-154289979 TTCCTGGGTGGTGGTGGTGGTGG - Intronic
1017478448 6:154824360-154824382 TTACCAGGTGGTGGTTGTGAAGG - Exonic
1017987318 6:159455661-159455683 CTCCTGGGTGGTGGTGTTCCTGG - Intergenic
1019259887 7:75884-75906 TTCTCGGGTGGCCGTTTTGTGGG - Intergenic
1020030068 7:4926485-4926507 TTCCTGGATGGTGGTTTAGTGGG - Intronic
1020126130 7:5533333-5533355 TGGCTGGGTGGTTGTTTTGCGGG - Intronic
1020365886 7:7379997-7380019 TTCCAGGGTTGTGGTCTAGCGGG - Intronic
1021123881 7:16827374-16827396 TTCCCGGATGGTCTTATTGCAGG - Intronic
1022700066 7:32751239-32751261 TTGACTGGTGATGGTTTTGCAGG + Intergenic
1032162743 7:129523198-129523220 TTCCTGGGTGGGTATTTTGCAGG - Intergenic
1037503279 8:19505777-19505799 TTCCCGGGTGGTGGTTTTGCTGG - Exonic
1040284800 8:46094256-46094278 CTCCCGGGTGGGGGTTTTCTGGG + Intergenic
1045198169 8:99951062-99951084 TGCCAGGTTTGTGGTTTTGCTGG + Intergenic
1049708727 8:144054335-144054357 CTCCCGAGGGGTGGTTTTGCGGG - Intronic
1051536519 9:18164438-18164460 TTCTCTGGTGGTGGTTTTAGGGG + Intergenic
1053351461 9:37416112-37416134 TTCCCGGGTGATGCTGCTGCTGG - Intergenic
1055077687 9:72233681-72233703 TTCCAGGGTGGTGGGATTACAGG - Intronic
1055766967 9:79673907-79673929 TTCCTGGGGGGTGATTTTGTAGG + Intronic
1061133576 9:128721346-128721368 TTCCCAGGTGGTGGTGTTGCTGG + Exonic
1061996008 9:134186428-134186450 TTCCTTGGTGGTGGTCTTGAGGG + Intergenic
1062744811 9:138204575-138204597 TTCTCGGGTGGCCGTTTTGTGGG + Intergenic
1185515032 X:692947-692969 TTCCTGGGTGGTGTTTATTCTGG + Intergenic
1185599182 X:1327310-1327332 AACCCGGGAGGTGGTTTTGCAGG + Intergenic
1186215571 X:7296699-7296721 TTCCAGGGTGTTGCATTTGCTGG - Intronic
1191783817 X:64896277-64896299 TTCTGGGATGGTGGTTTTGATGG - Intergenic
1196757937 X:119174129-119174151 TTCCCAGGTGGCAGATTTGCTGG - Intergenic
1196841672 X:119865007-119865029 GACCCGGGTGGTGGTTATGCAGG + Intergenic