ID: 1037507669

View in Genome Browser
Species Human (GRCh38)
Location 8:19547980-19548002
Sequence GAATCACTTAATACAATGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 599
Summary {0: 1, 1: 0, 2: 10, 3: 58, 4: 530}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037507669_1037507672 29 Left 1037507669 8:19547980-19548002 CCCGGCATTGTATTAAGTGATTC 0: 1
1: 0
2: 10
3: 58
4: 530
Right 1037507672 8:19548032-19548054 ACTCTGTGAGGTTGAAAGTCTGG No data
1037507669_1037507671 17 Left 1037507669 8:19547980-19548002 CCCGGCATTGTATTAAGTGATTC 0: 1
1: 0
2: 10
3: 58
4: 530
Right 1037507671 8:19548020-19548042 TCGCTCACATTAACTCTGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037507669 Original CRISPR GAATCACTTAATACAATGCC GGG (reversed) Intronic
901112977 1:6814025-6814047 GTAATACTTAATACAATGTCTGG - Intronic
902672733 1:17986045-17986067 TAAGCATTTAACACAATGCCTGG - Intergenic
902838779 1:19062512-19062534 TAAGCACTTAACACAACGCCTGG - Intergenic
902861573 1:19250662-19250684 AAATTACTTAGCACAATGCCTGG - Intronic
903050851 1:20599830-20599852 AAAGCACTTAACACAAAGCCTGG - Intronic
903240265 1:21978098-21978120 GATACACTTAGAACAATGCCTGG - Intronic
903244013 1:22002732-22002754 GATACACTTAGAACAATGCCTGG - Intronic
903390614 1:22961170-22961192 AAATCACTTTATGCCATGCCTGG - Intronic
903571548 1:24309283-24309305 AAAGCACTTAATATAGTGCCTGG - Intergenic
904032504 1:27542010-27542032 GCAGCACTGGATACAATGCCTGG + Intronic
904252092 1:29232306-29232328 GAAGCATTTAGTACAATGCTTGG + Intergenic
905444074 1:38013528-38013550 GAATCAGTTGATACACTGTCAGG + Intronic
905735447 1:40322499-40322521 GAAACACTTAAAAGAATACCTGG + Intergenic
905844650 1:41218702-41218724 AAAGCACTTAATACCATGCCTGG - Intronic
905853613 1:41292495-41292517 AAAGCACTTAGAACAATGCCTGG + Intergenic
906598429 1:47102280-47102302 AAATCAATTAATAAAATGACAGG - Intronic
906916766 1:50020795-50020817 AAAGCACTTAGTACAATGCGTGG + Intronic
907026083 1:51120834-51120856 CAGTGACCTAATACAATGCCTGG - Intronic
907550605 1:55301593-55301615 GAATCATTTACAACAATGCCTGG - Intergenic
907668263 1:56451902-56451924 AAAGCACTTAAAATAATGCCTGG - Intergenic
907825208 1:58009902-58009924 CAAGCATTTAATACAATACCTGG - Intronic
907878015 1:58513723-58513745 AATACACTTAAAACAATGCCTGG - Intronic
907931606 1:59006212-59006234 AAATCAATTAAAGCAATGCCTGG - Intergenic
908102490 1:60805978-60806000 AAATCAATTAATAAAATGACAGG - Intergenic
908115818 1:60938972-60938994 GAAGCACTCAATACAGTGCTTGG + Intronic
908367844 1:63444827-63444849 GAATCACCTAAAACAGGGCCAGG - Intronic
908834248 1:68212569-68212591 AAAATACTTAATACATTGCCTGG + Intronic
909340052 1:74521371-74521393 AAGTCACTTAAAACAATACCTGG + Intronic
909356917 1:74719957-74719979 GAGACACTTAATGCAGTGCCTGG - Intronic
910131146 1:83907987-83908009 GTAGCACTTAGCACAATGCCTGG - Intronic
910268540 1:85367539-85367561 AAATCACTTAGCACAATGCTTGG - Intronic
910688775 1:89944724-89944746 GAATTGCTTAGGACAATGCCTGG + Intergenic
911014921 1:93321828-93321850 GATTCACATAATTCAATTCCAGG - Intergenic
911419226 1:97618318-97618340 GAATCAAGTAATAAAATGTCAGG - Intronic
911442930 1:97951668-97951690 GAAACACTTAGAACAATGCCTGG - Intergenic
911456577 1:98131664-98131686 ACATCACCTAACACAATGCCTGG + Intergenic
911507918 1:98776550-98776572 CAAGTACTAAATACAATGCCTGG + Intergenic
911604288 1:99885356-99885378 AAAACACTTAATACAATGCCTGG + Intronic
912146470 1:106799870-106799892 AAATCACTCAATGCAGTGCCTGG - Intergenic
912267321 1:108171753-108171775 GAAATACTTAGAACAATGCCTGG - Intronic
912558144 1:110530966-110530988 AAAACACTTAGAACAATGCCTGG + Intergenic
912750987 1:112287394-112287416 GAATCTTTGAATACATTGCCAGG - Intergenic
912945950 1:114084307-114084329 AAAGCACTTAGAACAATGCCTGG + Intergenic
913225097 1:116692093-116692115 TAATCACTTAGCACAGTGCCTGG + Intergenic
913678240 1:121163074-121163096 GAAGCACTTGGAACAATGCCTGG + Intergenic
914030080 1:143950714-143950736 GAAGCACTTGGAACAATGCCTGG + Intronic
914159369 1:145117237-145117259 GAAGCACTTGGAACAATGCCTGG - Intergenic
914227707 1:145735172-145735194 ATATCACTTAGCACAATGCCTGG - Intronic
914390978 1:147222989-147223011 CAATCACTTACAACAGTGCCAGG - Intronic
915587286 1:156851038-156851060 AAAGCACATAAAACAATGCCTGG - Intronic
915884817 1:159711565-159711587 AAAGCACTTACTACAGTGCCTGG - Intergenic
915996859 1:160572509-160572531 AAAGCACTTAGCACAATGCCTGG + Intronic
916589153 1:166173777-166173799 AAATCTCCTACTACAATGCCTGG + Intergenic
917563658 1:176187741-176187763 GAGGCGCTCAATACAATGCCTGG + Intronic
918005825 1:180541317-180541339 GAAGCACTTAGAACAATGCCTGG + Intergenic
918433904 1:184491104-184491126 AAAACACTTAAAATAATGCCTGG + Intronic
918568484 1:185958619-185958641 AAAACACTTAGAACAATGCCTGG - Intronic
918666844 1:187161989-187162011 AAAGCACTTAAAACCATGCCTGG - Intergenic
919264532 1:195244744-195244766 TAATCACTTAATAAAATGCAAGG + Intergenic
920465547 1:206181598-206181620 GAAGCACTTGGAACAATGCCTGG + Intergenic
920712309 1:208306945-208306967 GAAGCAATTATTACCATGCCTGG - Intergenic
920868862 1:209776317-209776339 AAAGCACTTAGCACAATGCCTGG + Intronic
921253780 1:213321403-213321425 AAAGCACTTACCACAATGCCTGG + Intergenic
921760606 1:218909488-218909510 GAATCAATAAATACTATTCCAGG + Intergenic
922581228 1:226699587-226699609 AAACCACTTAGAACAATGCCTGG + Intronic
922604417 1:226880671-226880693 GAAGAACTTCAAACAATGCCTGG - Intronic
922653527 1:227361083-227361105 GAATGACTTCATATAATCCCAGG + Intergenic
923117812 1:230960037-230960059 CACTCACCTAGTACAATGCCTGG + Intronic
923117818 1:230960108-230960130 TAATCACCTAGTGCAATGCCTGG + Intronic
1062851311 10:744929-744951 AAATTACTTAATATAAGGCCAGG + Intergenic
1063855782 10:10252166-10252188 GAATCATTTAGTACTCTGCCTGG - Intergenic
1065820212 10:29518243-29518265 CAAGCACTTACTACCATGCCTGG - Intronic
1065984104 10:30932429-30932451 AAAGCACTTAGTACATTGCCTGG - Intronic
1068606539 10:59011379-59011401 GAAGCACTTAGCACAATGCCTGG + Intergenic
1068758413 10:60680937-60680959 AAATCACTTAGAACAGTGCCTGG + Intronic
1068790133 10:61019758-61019780 GAAGCACTTAACACAATGATAGG - Intergenic
1068949029 10:62759035-62759057 AAAGCACTTAGTATAATGCCTGG - Intergenic
1069627849 10:69879318-69879340 AAAGTACTTAAAACAATGCCTGG - Intronic
1070344061 10:75524498-75524520 AAAACACCTAATACAGTGCCTGG + Intronic
1071861343 10:89676115-89676137 AAAGCAATTAATACAGTGCCTGG + Intergenic
1072457469 10:95589299-95589321 AAAGCACTTAACACAATTCCTGG - Intergenic
1072907693 10:99469929-99469951 AAAGCACTTAAAACAGTGCCTGG - Intergenic
1073278825 10:102336479-102336501 AAATTGCTTAATACCATGCCTGG + Intronic
1073411637 10:103346893-103346915 TAAGCACTTAAAACAGTGCCTGG - Intronic
1073645525 10:105298133-105298155 AAATCAATTAATAAAATGACAGG + Intergenic
1074307110 10:112289124-112289146 GAAGCACTTAGCACAGTGCCTGG + Intronic
1074471831 10:113734485-113734507 GAAATGCTTAGTACAATGCCTGG + Intergenic
1074676041 10:115852464-115852486 AAAGCGCTTAATATAATGCCTGG - Intronic
1074752172 10:116597258-116597280 GTAGCACTTAGCACAATGCCTGG - Intronic
1075750073 10:124761191-124761213 GAAGCACTCAAAATAATGCCTGG - Intronic
1076086023 10:127632919-127632941 AAATCAATTAATAAAATGACAGG - Intergenic
1076087312 10:127645487-127645509 TACTCTTTTAATACAATGCCGGG - Intergenic
1077651542 11:3977591-3977613 AAAGCACTTAATACAATGCCTGG + Intronic
1078395943 11:10982168-10982190 AAAGAACTTAATACAATGCCTGG + Intergenic
1078792121 11:14554778-14554800 GAAGTACTTAGAACAATGCCTGG - Intronic
1079379065 11:19920601-19920623 AAAGCACTTAGTACAGTGCCTGG + Intronic
1079584202 11:22105469-22105491 AAAACACTTAAAACAGTGCCTGG + Intergenic
1080323244 11:31039802-31039824 GAAGCACTTAAAACAGTACCTGG + Intronic
1080775621 11:35383654-35383676 GAAGCATTTAAAACAATGCCTGG + Intronic
1080910044 11:36587562-36587584 CAAGTACTTAATATAATGCCTGG - Intronic
1080919580 11:36695690-36695712 AAATCACTTAATGGATTGCCTGG - Intergenic
1080981910 11:37417786-37417808 GATTCACTCAATACATTGCAAGG + Intergenic
1081430424 11:42970693-42970715 GAAGCATTTAATACAATGACTGG + Intergenic
1081496504 11:43616529-43616551 GAAGCACTTAGAACAATGCCTGG - Intronic
1081730310 11:45367482-45367504 AAATTACTTAGTACAGTGCCTGG + Intergenic
1083814145 11:65122611-65122633 GGAGCACTTAACACAGTGCCTGG + Intronic
1085324924 11:75599226-75599248 AGATCACTATATACAATGCCAGG + Intronic
1085544708 11:77306657-77306679 AAAGCATTTAATACAATCCCTGG - Intergenic
1085559637 11:77459508-77459530 TCATCACTTAGTACAATGCTTGG - Intronic
1085786838 11:79459720-79459742 AAAGCACTTAAAACAATGCTGGG - Intergenic
1086110366 11:83192638-83192660 AAAGCACTTAGTACAATGCCAGG + Intergenic
1086325616 11:85695818-85695840 GAAGCATTTAATACAGTGACTGG + Intronic
1087191801 11:95262481-95262503 GAAGCACTTAGAACCATGCCCGG + Intergenic
1087672138 11:101119995-101120017 GAAGCAGTTAAAACAGTGCCTGG + Intronic
1089090240 11:115868269-115868291 AAATCAATTAATAAAATGACAGG - Intergenic
1089624722 11:119743757-119743779 AAAGCACTTAGTACAGTGCCTGG - Intergenic
1089910479 11:122094400-122094422 GAATAACAAAATAGAATGCCAGG - Intergenic
1090911760 11:131127205-131127227 AAATCAATTAATAAAATGACAGG - Intergenic
1091578680 12:1765516-1765538 AAAGCACTTAGTACAATGTCTGG + Intronic
1091598026 12:1892602-1892624 AAATCAATTAATACAATGACAGG + Intronic
1092043463 12:5406130-5406152 GAAATACTTAATATGATGCCTGG - Intergenic
1092158106 12:6297921-6297943 GAAAAACTTAAAACAAAGCCGGG + Intergenic
1092681436 12:10986597-10986619 GAATTACTTCTTATAATGCCTGG - Exonic
1092699199 12:11208579-11208601 AAATCACTTAGAACAGTGCCTGG - Intergenic
1092837542 12:12505163-12505185 GAATCACGTAATATAATAACCGG + Intronic
1093384804 12:18539314-18539336 AAAGCACTTAGCACAATGCCTGG - Intronic
1093499575 12:19796917-19796939 AAATTACTTATTACAGTGCCTGG + Intergenic
1093646595 12:21592253-21592275 GAATCAATTAACAAAATGGCAGG + Intronic
1094474770 12:30832764-30832786 GAAGCACTCAGCACAATGCCCGG - Intergenic
1095353377 12:41241631-41241653 GAAACACTTAATATAGTGCAAGG + Intronic
1095583503 12:43826291-43826313 GAAACACTTAAAAGAGTGCCTGG - Intergenic
1095812952 12:46390595-46390617 GAAGCACTTAGAACCATGCCTGG + Intergenic
1096331916 12:50720886-50720908 GGATCACTTGAGCCAATGCCTGG - Intronic
1096442514 12:51656215-51656237 GCATCACTTAATAAAATGTCTGG - Intronic
1097700358 12:62813859-62813881 AAAACACTTAAATCAATGCCTGG + Intronic
1098192487 12:67964910-67964932 GAAGCACCTGAGACAATGCCTGG + Intergenic
1098225102 12:68313132-68313154 CCAGCACTTAAAACAATGCCTGG + Intronic
1098395120 12:70009019-70009041 AAATCAATTAATAAAATGACAGG + Intergenic
1098646300 12:72905613-72905635 GAATCACTTAAGACCATTCTTGG - Intergenic
1099536585 12:83853427-83853449 AAATCAATTAATAAAATGACAGG - Intergenic
1099556292 12:84111795-84111817 GAAACACTTAATATGATGACAGG + Intergenic
1099950859 12:89302374-89302396 GATTCATTTAAAACAATGCTTGG + Intergenic
1099975083 12:89538125-89538147 AAAGCACTTAGTACAGTGCCTGG + Intergenic
1100216404 12:92454306-92454328 AAATCACTTAAGATAATGCCTGG - Intergenic
1100380032 12:94053313-94053335 GAAGCTTTTAACACAATGCCTGG + Intergenic
1100516972 12:95337689-95337711 GAATAACTTAGCACAGTGCCTGG + Intergenic
1100601847 12:96118469-96118491 AAAGCACTTAAAACAATGCCTGG - Intergenic
1101227355 12:102702844-102702866 GAATCACTTAGTACATTGCCTGG - Intergenic
1101925846 12:108970716-108970738 GAATCTCTTTGTACAATGCCAGG - Intronic
1102739194 12:115191732-115191754 TAAGCATTTAATACAATTCCTGG + Intergenic
1103256513 12:119546145-119546167 GAAGCACTTAGAACAATGCGTGG - Intergenic
1103857952 12:123987451-123987473 GAAGTACTTAAAACACTGCCTGG - Intronic
1104173512 12:126305318-126305340 GAATCACTGACAACAGTGCCTGG - Intergenic
1104827353 12:131722602-131722624 GAAGCACTTAGTACACTGTCTGG - Intronic
1105061757 12:133159123-133159145 GAATCACATAAAAGAGTGCCTGG + Exonic
1105316201 13:19266365-19266387 GAATGACTTAATACAGTGCCTGG + Intergenic
1105819943 13:24071282-24071304 GGATCACTTCAGACAATGTCTGG - Intronic
1105877930 13:24575832-24575854 AAATCAATTAATAAAATGACAGG - Intergenic
1106405084 13:29466219-29466241 CTATCACTTGATGCAATGCCAGG - Intronic
1107094550 13:36520977-36520999 AAATCTTTTAATACAATGCCTGG - Intergenic
1107296364 13:38913452-38913474 GAGTGACTTAATACAGTACCTGG + Intergenic
1107632813 13:42359636-42359658 AAATCCCTTAGAACAATGCCTGG + Intergenic
1108635172 13:52326755-52326777 AAATCAATTAATAAAATGACAGG + Intergenic
1108652635 13:52496474-52496496 AAATCAATTAATAAAATGACAGG - Intergenic
1108678663 13:52760655-52760677 GAATCTTTTAATACAGTTCCAGG - Intergenic
1109661703 13:65467906-65467928 AAATCACTTAATATTATGCTTGG + Intergenic
1110741042 13:78997472-78997494 GAAGCACTTAACACAGTGGCTGG - Intergenic
1111212309 13:85095282-85095304 GAAGCACTTAGGACAATGTCTGG + Intergenic
1111787945 13:92815158-92815180 AAAACATATAATACAATGCCAGG + Intronic
1115431995 14:33329840-33329862 GAAGTGCTTAAAACAATGCCTGG + Intronic
1116473266 14:45309929-45309951 AAAGCTCTTAAAACAATGCCTGG - Intergenic
1116711812 14:48377612-48377634 AAATCATTAAATTCAATGCCAGG + Intergenic
1117100270 14:52338819-52338841 GAAATACTTAAAACAATGTCTGG + Intergenic
1117321547 14:54628645-54628667 CAAGTACTTAGTACAATGCCTGG - Intronic
1118453981 14:65928999-65929021 GAAGCACTTAGAACAGTGCCTGG - Intergenic
1118689583 14:68325261-68325283 AAAACACTTAGCACAATGCCTGG + Intronic
1119349716 14:73954129-73954151 CAAACACATAATATAATGCCAGG - Intronic
1119449863 14:74700189-74700211 GTAGCACTTTATACAATGCCTGG - Intronic
1120237279 14:81906447-81906469 AAAGCACTTAGCACAATGCCTGG + Intergenic
1120291725 14:82582324-82582346 TAAGCACTTAATACAGTGGCTGG + Intergenic
1120746373 14:88156012-88156034 TAATCACTTGTTAAAATGCCTGG - Intergenic
1120836565 14:89043144-89043166 AAAGCACTTAACATAATGCCTGG - Intergenic
1121044086 14:90775283-90775305 AAAGCACTTAGCACAATGCCCGG - Intronic
1122243632 14:100385008-100385030 GAATCACCAAGTGCAATGCCTGG + Intronic
1122729319 14:103783845-103783867 GAATTATTTAAAACAAAGCCTGG - Intronic
1124205455 15:27714984-27715006 GAAACAGTCAATACAATGCTTGG - Intergenic
1124809219 15:32917533-32917555 AAAACACTTAGAACAATGCCTGG - Intronic
1125317338 15:38445197-38445219 GAAGCAGTTAAGACTATGCCTGG + Intergenic
1126325746 15:47475251-47475273 AAATGACTTAGCACAATGCCTGG - Intronic
1126652338 15:50937448-50937470 ACACCACTTTATACAATGCCTGG - Intronic
1126822215 15:52515511-52515533 GAAGCACTTAGAATAATGCCTGG - Intronic
1126836634 15:52673552-52673574 GAAGTACTTAAGACAGTGCCTGG + Intronic
1126961871 15:54005523-54005545 AAAGCACTCAAGACAATGCCTGG + Intergenic
1127010218 15:54617556-54617578 GAAGCACTTAGCACAATGCCTGG + Intronic
1127224407 15:56915143-56915165 GAAACATTTAACACCATGCCCGG + Intronic
1127241662 15:57122431-57122453 TAAACACTTCTTACAATGCCTGG - Intronic
1127345654 15:58095150-58095172 AAAGCACTTAAAATAATGCCTGG - Intronic
1127824954 15:62695013-62695035 AAAGCACATAAAACAATGCCTGG + Intronic
1129165120 15:73772660-73772682 AAAGCACTTAACACAGTGCCTGG + Intergenic
1130718711 15:86364298-86364320 AAATCACTTAGCACAATGCCTGG - Intronic
1131467943 15:92670428-92670450 GAAGTGCTTAACACAATGCCAGG + Intronic
1131527774 15:93166346-93166368 AAAGCACTTAGGACAATGCCAGG - Intergenic
1131723971 15:95202532-95202554 GAGTCACTTGATAAATTGCCTGG - Intergenic
1135028742 16:19019491-19019513 GAAGTGCTTAACACAATGCCTGG - Intronic
1135063674 16:19291530-19291552 CAAGCATTTAACACAATGCCTGG + Intronic
1135196340 16:20398132-20398154 GAAGCACTTAGGACAGTGCCAGG + Intronic
1135269159 16:21054073-21054095 CAATCACTTAGCACAAAGCCTGG + Intronic
1135397337 16:22141341-22141363 AAAGCACTTAGCACAATGCCAGG + Intronic
1137341071 16:47606035-47606057 GAAATACTTAAAACAATGCCTGG + Intronic
1137425284 16:48374236-48374258 CAAAAACTTAATACAGTGCCTGG + Intronic
1137633813 16:49968101-49968123 GAATCACTTGATAAAAGGGCTGG + Intergenic
1137794495 16:51203969-51203991 GAATCACTTAGCACAGGGCCTGG - Intergenic
1137906683 16:52330669-52330691 GAAGCACTTAACACAGTACCTGG + Intergenic
1138463288 16:57166832-57166854 GAAGCACTTAACACAATGCCTGG + Intronic
1138738141 16:59276925-59276947 GAATCACTTAACACAGTACCTGG - Intergenic
1139333968 16:66217877-66217899 AAATCACTTAGAACATTGCCTGG + Intergenic
1140655867 16:77138577-77138599 GAATGACTTAAAAGAATTCCAGG - Intergenic
1143043104 17:4054291-4054313 CTAGCACTTAGTACAATGCCTGG - Intronic
1143271248 17:5676608-5676630 GAAACCCTTAACACAATGCCTGG - Intergenic
1143349147 17:6274659-6274681 AAAGCACTTGACACAATGCCTGG - Intergenic
1143583097 17:7837726-7837748 AAATCACTTAGCACAGTGCCTGG + Intergenic
1143583743 17:7841174-7841196 AAAATACTTAATACAGTGCCTGG + Intronic
1144125804 17:12202047-12202069 ACAGTACTTAATACAATGCCAGG - Intergenic
1146712374 17:35053683-35053705 AAAGTACTTAATACAATACCAGG + Intronic
1146920685 17:36708445-36708467 AAAGCATTTAACACAATGCCTGG - Intergenic
1147361294 17:39932282-39932304 GAAACACTCAAAACAATTCCTGG + Intergenic
1147497198 17:40928031-40928053 GAACTACTTAGCACAATGCCTGG + Intronic
1148994493 17:51697770-51697792 AAATCACTCAGTACAGTGCCTGG + Intronic
1149085676 17:52712871-52712893 AAAGAACTTAAAACAATGCCTGG - Intergenic
1149143928 17:53467114-53467136 GAAGCTCTTATTACAAGGCCTGG + Intergenic
1149605238 17:57919982-57920004 GAAGCACTTAGTCCAGTGCCTGG - Intronic
1149941411 17:60871627-60871649 ACTTCACTAAATACAATGCCTGG - Intronic
1150471516 17:65441443-65441465 GAACCACTTAGGACAGTGCCTGG - Intergenic
1150903086 17:69304199-69304221 GAACCACTTAAAACAAAGGCTGG + Intronic
1151312755 17:73304222-73304244 AAATCACCTAACACAATGCCTGG - Intronic
1151574122 17:74942997-74943019 GAAGCACCCAACACAATGCCTGG - Intronic
1153194335 18:2577126-2577148 AAAGCACTTAAAACAATGTCTGG - Intronic
1155596911 18:27498660-27498682 AACTCACTTAATACCCTGCCTGG - Intergenic
1155851239 18:30777162-30777184 AAATAACTTAATACCATGCTTGG - Intergenic
1156183790 18:34638105-34638127 GGATCACATAATAAAATGCTTGG + Intronic
1156233200 18:35174972-35174994 GAAACACTTAGAACAGTGCCTGG - Intergenic
1156435346 18:37121628-37121650 GAATTACTTTATATAATGACTGG + Intronic
1156650325 18:39218375-39218397 GAAACACTTACAACAATGCATGG + Intergenic
1156714719 18:39994178-39994200 AAATCACTTAACACAATGAATGG - Intergenic
1157913058 18:51637429-51637451 AAATGACTTAATACATTACCTGG + Intergenic
1158081389 18:53595056-53595078 TAATCACCTAATACAGTGGCTGG + Intergenic
1158778605 18:60617995-60618017 GAAACAAATAATACAATGCATGG - Intergenic
1158986173 18:62819425-62819447 GAATCAGTTAATACAAAACAAGG + Intronic
1159178606 18:64871596-64871618 AAAGTACTTAGTACAATGCCTGG - Intergenic
1162202720 19:9032829-9032851 CAAACACTTAACACAATGCCTGG - Intergenic
1162269812 19:9604971-9604993 GAATCACTGAAATAAATGCCTGG + Intronic
1162325808 19:9998533-9998555 GAATGAATTAAAACAATGCTTGG + Intronic
1164373000 19:27657911-27657933 GAATCTCCCATTACAATGCCTGG + Intergenic
1164381429 19:27739872-27739894 GTATCTCTTATTAGAATGCCTGG + Intergenic
1164385020 19:27764883-27764905 GTCTCTCTTAAGACAATGCCTGG + Intergenic
1164701614 19:30288755-30288777 GATGCACTTAAAACACTGCCTGG + Intronic
1165722327 19:38088385-38088407 GAAACACTTAGTACAGTGCATGG - Intronic
1166170350 19:41024012-41024034 AAAGCACTTAATGCAGTGCCTGG + Intergenic
1167109220 19:47449059-47449081 CCAACACTTAAAACAATGCCTGG - Intronic
1167194506 19:48018545-48018567 GAAGCACTTAAAATACTGCCTGG - Intronic
1167444881 19:49531770-49531792 AAAGCACTTAGGACAATGCCTGG - Intronic
1167637442 19:50662989-50663011 AAAGCACTTAGAACAATGCCTGG - Intronic
1168351248 19:55677326-55677348 AAAGCACTTAAAACAGTGCCTGG + Intronic
925374744 2:3376179-3376201 GAATCACGTAGAACAGTGCCTGG - Intronic
926944432 2:18171403-18171425 GAAGCACTTGAAACAATGCCTGG + Intronic
926989700 2:18664810-18664832 AAAAAGCTTAATACAATGCCCGG + Intergenic
928071317 2:28220350-28220372 GAAGCTCTTAATATAATGCCTGG + Intronic
928123956 2:28603454-28603476 AAAGCACTTGAAACAATGCCTGG - Intronic
928334734 2:30387080-30387102 AAAATACTTTATACAATGCCTGG + Intergenic
928575172 2:32647234-32647256 AAAACACATAATACAAGGCCAGG - Intronic
928656447 2:33456879-33456901 AAAGCACTTAGCACAATGCCTGG - Intronic
930337512 2:50068632-50068654 CAATCTCTTAGCACAATGCCTGG + Intronic
930670825 2:54148433-54148455 GAAGCACTTAGTGCAGTGCCTGG + Intronic
931091302 2:58889553-58889575 GAAGGACTTAAAACAGTGCCTGG - Intergenic
931691852 2:64840436-64840458 AAATCACTTAGCACAATGCCTGG + Intergenic
931954517 2:67405559-67405581 CCAGCACTTAATACAATGACTGG + Intronic
933526419 2:83446141-83446163 GATTACCTTAATACAATGCCAGG + Intergenic
935615362 2:105074522-105074544 GAAGCACTTAGAACTATGCCTGG - Intronic
936100320 2:109572045-109572067 GAAGCATTTAGTACAATGCCTGG - Intronic
937159012 2:119742505-119742527 GAAGCACATACTACCATGCCTGG + Intergenic
938553974 2:132407220-132407242 AAAACACTTAAAACAATGCTAGG - Intergenic
938986853 2:136584905-136584927 GAAGCACTTAGCACAATGACTGG + Intergenic
939724400 2:145698260-145698282 GAAGAATTTAAAACAATGCCGGG + Intergenic
939936904 2:148304185-148304207 AAAACACTTAAAACAGTGCCTGG - Intronic
940259084 2:151761827-151761849 GAGTTACATAATACAATGCAAGG - Intergenic
940487201 2:154310886-154310908 AAATCACTTAAGACAATGTCTGG + Intronic
940539032 2:154986948-154986970 AAAGCACTTAGAACAATGCCTGG + Intergenic
940567232 2:155382377-155382399 AAAACACTTATTACAATGTCTGG - Intergenic
941082333 2:161076802-161076824 AAGACACTTAAAACAATGCCAGG + Intergenic
941419818 2:165269570-165269592 AAAACACTTAAGACAATTCCTGG + Intronic
941559610 2:167028180-167028202 AAACTGCTTAATACAATGCCTGG - Intronic
941612618 2:167679779-167679801 AAAACACTTAACTCAATGCCTGG + Intergenic
941619431 2:167759452-167759474 AAATCACTTAGCACAGTGCCTGG + Intergenic
942124163 2:172806492-172806514 AAAGCACTTAGTACAAAGCCTGG + Intronic
942376323 2:175341496-175341518 GAAGCAATTAATAAAATGACAGG - Intergenic
942397997 2:175572530-175572552 GAAGCACTTAGCACAATTCCAGG + Intergenic
942959267 2:181810629-181810651 AAATCTCTTATTATAATGCCTGG + Intergenic
943980298 2:194540756-194540778 AAATCAATTAATAAAATGACAGG + Intergenic
944048768 2:195442419-195442441 AAATCACTTAGTAAAATGACAGG + Intergenic
945288538 2:208106309-208106331 TAAACACTTAACACACTGCCTGG - Intergenic
945480473 2:210339240-210339262 AAATCACTGAATAAAATGACAGG - Intergenic
946035568 2:216739644-216739666 GAAGCACTTAGGACAGTGCCTGG - Intergenic
946282134 2:218673221-218673243 AAATCACTTAGTACAGTGCCTGG + Intronic
947186693 2:227461737-227461759 AAAGCACTTAAAACAATGTCTGG - Intergenic
947417064 2:229907861-229907883 AAAACATTTAAAACAATGCCTGG - Intronic
947566489 2:231197457-231197479 GATTCACTTAGCACAATGCTGGG + Intergenic
1168770382 20:410701-410723 GAAACACTTTGCACAATGCCTGG + Intronic
1169296092 20:4401011-4401033 AAACCACTTAGTACAATACCTGG - Intergenic
1169457686 20:5766659-5766681 GAAGCTCTTAGCACAATGCCTGG + Intronic
1169524009 20:6403186-6403208 GAAGCAATTAACCCAATGCCTGG - Intergenic
1169877096 20:10309938-10309960 GAAGCACTTAGCACAATGCCTGG - Intergenic
1170588837 20:17755714-17755736 TAAGCGCTTAATACCATGCCTGG - Intergenic
1171988326 20:31676238-31676260 GAAGCACTTAGCACCATGCCTGG - Intronic
1171991714 20:31701717-31701739 AAATCACTGAATACAGTGCTTGG + Intronic
1172009424 20:31837734-31837756 GAATCACTTGGTATAGTGCCTGG - Intergenic
1172459148 20:35102321-35102343 CAAACACTTAGTACAATGTCCGG - Intergenic
1172591336 20:36120158-36120180 GAATCACTTATAACCACGCCTGG - Intronic
1172840428 20:37899942-37899964 AAAGCACTTAGAACAATGCCAGG - Intergenic
1172972246 20:38882118-38882140 GAAGGGCTTAACACAATGCCTGG + Intronic
1173879764 20:46403329-46403351 GCAGCAGCTAATACAATGCCTGG + Intronic
1173899129 20:46574181-46574203 GAAGCACTTCAAACAATGGCTGG + Intronic
1173977142 20:47195595-47195617 GAGTCACTTCAGACAGTGCCTGG + Intergenic
1174109872 20:48191580-48191602 AAAGCACTTAGCACAATGCCAGG - Intergenic
1174674328 20:52338901-52338923 AAAGAACTTAATACAGTGCCTGG - Intergenic
1175043504 20:56079005-56079027 GAAGCATTTAGAACAATGCCTGG + Intergenic
1175166930 20:57050616-57050638 TAAGCACTTAGTACAAAGCCTGG + Intergenic
1175228277 20:57457952-57457974 GGAGCACTTAGAACAATGCCTGG - Intergenic
1175739360 20:61409880-61409902 CAATCTCTTAACACAAAGCCTGG - Intronic
1178107059 21:29331799-29331821 GAAGAACTTAGAACAATGCCTGG + Intronic
1178294151 21:31394885-31394907 GAATCACTTTATACTATGGAAGG - Intronic
1178356757 21:31916020-31916042 AAAGCACTTAGTACAATGTCTGG - Intronic
1178412603 21:32377911-32377933 GAATCTCTTGATAAAATGCAAGG + Intronic
1178679617 21:34661981-34662003 AAATCAATTAATAAAATGACAGG + Intergenic
1179964725 21:44795715-44795737 GGAACACTTAATACACTGCTAGG + Intronic
1181580173 22:23823800-23823822 AAAACACTTGATACATTGCCTGG + Intronic
1181884005 22:26004614-26004636 ATATCACTTAGCACAATGCCTGG + Intronic
1182694333 22:32186349-32186371 AAAGCACTTAGTACAGTGCCCGG - Intergenic
1183055235 22:35300855-35300877 GAAATACTTAGAACAATGCCTGG + Intronic
1184315236 22:43682758-43682780 GAATCATTTAAGACGGTGCCTGG + Intronic
1184778210 22:46633706-46633728 GCATCACTTGAGACAATCCCAGG + Intronic
949488032 3:4559693-4559715 AAAACACTTAATAAAATGGCTGG - Intronic
949536324 3:4998835-4998857 GAATCACTTAAAATAGTGCCTGG - Intergenic
949768886 3:7556580-7556602 TCATCAGTTAGTACAATGCCTGG - Intronic
950133159 3:10561399-10561421 GATTCACTTATTTAAATGCCAGG - Intronic
950849360 3:16048157-16048179 GAAGAACTTAGGACAATGCCTGG - Intergenic
951051168 3:18095801-18095823 GGAGCACTTAGTACAGTGCCTGG + Intronic
951406662 3:22308488-22308510 GAATCACTTAATGGAATTCAAGG - Intronic
951730222 3:25802283-25802305 GAGGCACTTGAAACAATGCCTGG - Intergenic
952243509 3:31560216-31560238 AAATCAATTAATAAAATGACAGG - Intronic
952676397 3:36036262-36036284 AAAACACTTAATGCCATGCCAGG + Intergenic
952893565 3:38061069-38061091 AAATCTCTTAGCACAATGCCTGG - Intronic
953313412 3:41902890-41902912 AAAGCACTTAAAACAATGCCTGG + Intronic
954512159 3:51134970-51134992 GAAATACTTAAAACAATGCCTGG + Intronic
955023748 3:55147009-55147031 GAAGTGCTTGATACAATGCCTGG + Intergenic
955040682 3:55314809-55314831 GAATCACTTGTTTCAAGGCCAGG - Intergenic
955856095 3:63275747-63275769 AAAGCACTTAGCACAATGCCTGG + Intronic
955876964 3:63501026-63501048 TAATTGCTTAATACAGTGCCTGG + Intronic
956086170 3:65613291-65613313 AAATCACTTAGCACAGTGCCTGG + Intronic
956351747 3:68344756-68344778 AAAGCACTTAGCACAATGCCTGG - Intronic
956802221 3:72770021-72770043 AAAGCACTTAGCACAATGCCTGG + Intronic
958905529 3:99937847-99937869 GAAGCACTTAAAACAGTGCCTGG - Intronic
959530212 3:107427817-107427839 GATTGACTTTATGCAATGCCAGG + Intergenic
959887333 3:111517733-111517755 GAACCACTTAACACAATGCCTGG - Intronic
960025961 3:113009785-113009807 AAAGCACTTAGAACAATGCCTGG + Intronic
960041563 3:113155090-113155112 GAAGCACTTAAAATAATGGCAGG + Intergenic
961252223 3:125517198-125517220 GAAGCACTGATTTCAATGCCAGG + Intronic
962231600 3:133670276-133670298 GAAGCACTTAGTACAATGCCTGG + Intergenic
962777021 3:138671240-138671262 GAAGAACTTAATACAATGCCTGG + Intronic
963416942 3:145008542-145008564 TAATCAGTTCATACAAGGCCTGG - Intergenic
963670869 3:148250570-148250592 GAAACACTTAGGACAATGCCTGG - Intergenic
963829934 3:149995594-149995616 AAATCAATTAATAAAATGACAGG + Intronic
964084595 3:152800635-152800657 GAAGCCCTTGATACTATGCCAGG - Intergenic
964405544 3:156344651-156344673 GAATCACTCAAAACCATCCCAGG - Intronic
964623888 3:158740559-158740581 GAAGCATTTAGGACAATGCCTGG + Intronic
964792060 3:160461648-160461670 GAATGATTTAATAAAGTGCCTGG - Intronic
965932007 3:174055757-174055779 AAAACACTTAAAACAATGCTTGG + Intronic
966005384 3:175005130-175005152 AAATTACTTAGAACAATGCCGGG - Intronic
967038989 3:185672032-185672054 TAAACACTTAGCACAATGCCTGG - Intronic
967944753 3:194795152-194795174 AAATCAATTAATAAAATGACAGG - Intergenic
967999517 3:195195246-195195268 AAAGCACTTAGAACAATGCCTGG + Intronic
970351745 4:15208388-15208410 TAAACACTTGGTACAATGCCTGG - Intergenic
970491756 4:16582387-16582409 GGATCCCTTCATAAAATGCCAGG + Intronic
970492352 4:16587263-16587285 AAAGCACTTAGAACAATGCCTGG - Intronic
971808451 4:31392068-31392090 AAAACACTTAACACACTGCCTGG - Intergenic
972294305 4:37721919-37721941 GTATCACTTAGCACAGTGCCTGG + Intergenic
972580634 4:40392996-40393018 GAAACACTTAGTCCAGTGCCTGG + Intergenic
972590326 4:40479892-40479914 GAAACACTTAGAACAGTGCCTGG - Intronic
972646806 4:40975875-40975897 GAATCAGTTAATCCAAGTCCTGG - Intronic
972837204 4:42886740-42886762 GAATCAATTAATAAAATGACAGG - Intergenic
972994466 4:44863354-44863376 GAATTCCCTACTACAATGCCAGG - Intergenic
973078156 4:45956538-45956560 AAATTACTTAATACAATTACCGG + Intergenic
974060756 4:57032902-57032924 TAATCAGTTAAAACAATGCTTGG + Intronic
974097133 4:57375689-57375711 AATGCACTTAACACAATGCCTGG + Intergenic
974578342 4:63759956-63759978 AAATAACTTAGAACAATGCCTGG + Intergenic
975820338 4:78264725-78264747 GAAGCACTTAGAACAGTGCCTGG + Intronic
975963871 4:79945460-79945482 GAAACACTTAAAAGATTGCCTGG - Intronic
976110867 4:81672434-81672456 GAATTACTCAATCCCATGCCAGG + Intronic
976236801 4:82905779-82905801 AAATCTCCTAGTACAATGCCTGG - Intronic
976530765 4:86149707-86149729 AAATTAGTTAATACAGTGCCTGG - Intronic
976552001 4:86407184-86407206 CAAAGACTTAATACAAAGCCTGG - Intronic
976664982 4:87580762-87580784 AAAGCACATAATACAGTGCCTGG - Intergenic
977139755 4:93354048-93354070 AAATTACTTAATACAGTGTCTGG - Intronic
978090118 4:104705596-104705618 ATAGCACTTAATACAGTGCCTGG - Intergenic
978267811 4:106847821-106847843 AAAGCACTTAAAACAGTGCCTGG + Intergenic
978333557 4:107641954-107641976 AAATCATTTAACACATTGCCTGG - Intronic
978783668 4:112584047-112584069 ATATCACTTAAAACCATGCCAGG + Exonic
979392723 4:120145443-120145465 AAAGCACTTAAAACAGTGCCGGG + Intergenic
979772369 4:124543596-124543618 GAATCACTTAAAACAATACCTGG - Intergenic
981073215 4:140567063-140567085 GAAGCACTTAGAACAATGTCTGG + Intronic
981379449 4:144056154-144056176 AAATCACTTACTAGAGTGCCTGG + Intergenic
981435042 4:144710326-144710348 GATTCACAGAAGACAATGCCTGG - Intronic
981995055 4:150965038-150965060 GAATAAATTAATATAATCCCTGG + Intronic
982360821 4:154517246-154517268 AACTCACCTAATACGATGCCTGG + Intergenic
983056692 4:163105346-163105368 TTACCACTTAACACAATGCCTGG + Intergenic
984024634 4:174528486-174528508 GAAGCACCCAGTACAATGCCTGG + Intergenic
984229681 4:177079718-177079740 AAATCACTTAGAACAATGTCTGG + Intergenic
986564818 5:9101449-9101471 GAAGCACTTTAAACAATACCTGG + Intronic
986873968 5:12083250-12083272 AAATCAATTAATAAAATGACAGG + Intergenic
987156923 5:15097850-15097872 AAAGCACTTAGTACAGTGCCTGG - Intergenic
987241070 5:16000165-16000187 AAAACACTTAACACAATTCCTGG + Intergenic
987359179 5:17091526-17091548 GAAGCACTTAACACAATACTTGG - Intronic
988422933 5:31028353-31028375 AAAGCATTTAGTACAATGCCTGG + Intergenic
988631759 5:32938926-32938948 AAAGCACTTAGTACAGTGCCTGG - Intergenic
988905834 5:35787719-35787741 AAAGCACTTAACAGAATGCCTGG + Intronic
988999055 5:36742289-36742311 AAAACACTTAACACAGTGCCTGG - Intergenic
989782623 5:45287499-45287521 GAATTACTTAGCACAATGCCTGG + Intronic
990824370 5:59880502-59880524 GAATCAGTTAAAACAATCTCTGG + Intronic
991124191 5:63051116-63051138 GAAGCACTTGGCACAATGCCAGG - Intergenic
991565450 5:67999676-67999698 CTATCACTTAGTACAGTGCCTGG - Intergenic
991949496 5:71933712-71933734 GAATCAATTAAAATAGTGCCTGG + Intergenic
993089048 5:83400965-83400987 AAAGCACTTAAAACAATGTCTGG - Intergenic
993369959 5:87080561-87080583 GAATCACTTAGCACATTGACTGG + Intergenic
993383047 5:87229927-87229949 GAATCACTAAGAACAATGACAGG + Intergenic
993523599 5:88936780-88936802 GAAACACTTAAAATAATGACTGG + Intergenic
993851245 5:93012555-93012577 GAATCACTTAGCACAGTTCCTGG - Intergenic
993921554 5:93811000-93811022 AAAGCACTTAAAACAACGCCTGG + Intronic
993956702 5:94243155-94243177 AAAACACTTAGAACAATGCCTGG + Intronic
994082663 5:95724845-95724867 AAAGCACTTAATGTAATGCCTGG + Intronic
994203623 5:97007460-97007482 GAAGCACCTAGAACAATGCCTGG + Intronic
996278557 5:121698526-121698548 CCATCACTTATTACAATGACTGG - Intergenic
996300496 5:121978160-121978182 AAAACACATAATATAATGCCTGG - Intronic
996534473 5:124562872-124562894 GAATCACAGAAGACACTGCCGGG + Intergenic
996836192 5:127795413-127795435 GAGACACTTAGAACAATGCCTGG - Intergenic
996879873 5:128284177-128284199 GAAACCCTTAGTACAATGCTTGG - Intronic
997781751 5:136666618-136666640 AACTCACTTAATAAACTGCCAGG + Intergenic
997869181 5:137491972-137491994 GAAGCTCTTAGCACAATGCCTGG - Intronic
998319977 5:141220266-141220288 CAAACACTTCATACATTGCCTGG + Intergenic
998889782 5:146733988-146734010 AAAGCACTTAAAACAATTCCTGG - Intronic
999312339 5:150559531-150559553 GAATCACTTAATTGAAAACCAGG + Intergenic
999318337 5:150598523-150598545 GAAACGCTTAGTACAGTGCCCGG + Intergenic
999653609 5:153791689-153791711 AAAGTGCTTAATACAATGCCTGG + Intronic
999817658 5:155193516-155193538 GAAGCACTTAGAACAGTGCCTGG - Intergenic
1000031309 5:157404092-157404114 AAATCAATTAATAAAATGACAGG + Intronic
1000493558 5:161947566-161947588 AAAGTGCTTAATACAATGCCTGG + Intergenic
1001081420 5:168670382-168670404 AAAGCACTTAACACAATTCCTGG - Intronic
1001200115 5:169708316-169708338 AAAGCACTTAAAACAGTGCCTGG - Intronic
1001386194 5:171341300-171341322 GAAACACTTAGAACAGTGCCTGG - Intergenic
1001674614 5:173501582-173501604 GAAACACTCACTCCAATGCCTGG + Intergenic
1001752740 5:174143983-174144005 GAAGCACTTAGCACAGTGCCTGG - Intronic
1003128044 6:3371779-3371801 GTAGCACTTAACACAGTGCCTGG - Intronic
1003331978 6:5136565-5136587 TAATGTCTTACTACAATGCCTGG + Intronic
1003818721 6:9871087-9871109 AAAGCACTTAAAACAATGCCTGG + Intronic
1005176285 6:23048335-23048357 AAAGCACTTAGTACAATGCTTGG - Intergenic
1005765601 6:29008369-29008391 AAATCACTTAACACATTGCCTGG + Intergenic
1006865107 6:37203110-37203132 GCCTCACTTAGCACAATGCCTGG + Intergenic
1007267954 6:40611427-40611449 TAAGCACCTAGTACAATGCCTGG - Intergenic
1007286355 6:40750555-40750577 AAAGCACTTGATACAAGGCCTGG + Intergenic
1007299521 6:40856308-40856330 GAAGCACTTAGCACAATACCTGG + Intergenic
1007308532 6:40926322-40926344 AAAGCACTTAGTACAGTGCCTGG + Intergenic
1007492132 6:42231390-42231412 GAATCCTTTAAAACAGTGCCAGG + Intronic
1007955855 6:45917292-45917314 AAAGCACCTAATACAGTGCCTGG + Intronic
1008291959 6:49726484-49726506 TAAATACTTAATACAATGTCAGG - Intergenic
1008703455 6:54129354-54129376 CCATCACCTAATACAATGCCTGG + Intronic
1010348464 6:74841380-74841402 AAAGCACTTAGTATAATGCCAGG - Intergenic
1011057321 6:83219111-83219133 GAATGATTTAAAACAATGACTGG + Intronic
1011994945 6:93574693-93574715 AAAGCATTTAATACAATGTCTGG - Intergenic
1012114382 6:95276939-95276961 AACCCACTTAATACAATGACTGG + Intergenic
1012197248 6:96358745-96358767 TAAACACTTAGAACAATGCCTGG + Intergenic
1012996333 6:105979353-105979375 AAAGCACATAACACAATGCCTGG + Intergenic
1013432937 6:110071705-110071727 AAATCACTTATCACAGTGCCTGG - Intergenic
1013652015 6:112205162-112205184 GAAACACTTAGAACAATGCCAGG + Intronic
1015429014 6:133107921-133107943 AAAACACTTAACACATTGCCTGG + Intergenic
1017240721 6:152165099-152165121 GAATCACTTCTTTAAATGCCTGG - Intronic
1017676572 6:156820380-156820402 CTAGCACTTAGTACAATGCCTGG - Intronic
1019096939 6:169589489-169589511 GAATGACATAATACAGTGGCAGG + Intronic
1021441547 7:20682667-20682689 GAAGCACCTAAGACAATGCCTGG + Intronic
1021468711 7:20976667-20976689 CTATCACTTAATACAGTGCCTGG - Intergenic
1021951263 7:25777177-25777199 AGAGCACTTAACACAATGCCTGG - Intergenic
1022515562 7:30972892-30972914 AAAGCACTTAGTGCAATGCCTGG - Intronic
1023353983 7:39349229-39349251 AAATCACTTCATAAAATACCTGG + Intronic
1024114816 7:46182612-46182634 GAAAAACTTAAAACAATGCTAGG - Intergenic
1026257892 7:68728524-68728546 AAAGCACTTAGAACAATGCCTGG - Intergenic
1026967382 7:74448859-74448881 GAATCACTTAACATCAGGCCTGG - Intergenic
1027057765 7:75061852-75061874 TATTGACTTAACACAATGCCTGG - Intronic
1027532288 7:79351838-79351860 TAATCACTCACCACAATGCCTGG - Intronic
1027538961 7:79443890-79443912 GAGTCACTTAATAAAATCCATGG + Intronic
1027754312 7:82192276-82192298 AAATTACCTAATACAATGCTTGG - Intronic
1027759521 7:82260249-82260271 AAAACACTTAGAACAATGCCTGG + Intronic
1028199381 7:87943200-87943222 AAATCACTCAATACAATGCCTGG - Intronic
1028647852 7:93118775-93118797 GAAACATTTAGAACAATGCCTGG - Intergenic
1029908838 7:104122067-104122089 CATTCACCTAACACAATGCCTGG + Intergenic
1029982722 7:104894286-104894308 AAAGCACTTAGCACAATGCCTGG + Intronic
1030008952 7:105146728-105146750 AAAACATGTAATACAATGCCAGG + Intronic
1030294694 7:107910732-107910754 AAAACACTTAATGCAGTGCCTGG + Intronic
1030868489 7:114728751-114728773 AAATCAATTAATAAAATGACAGG - Intergenic
1030926293 7:115459565-115459587 AAAGCACTTAAAACAATACCTGG - Intergenic
1032533586 7:132642371-132642393 CAATCACTTAATACTATACAGGG - Intronic
1034396743 7:150831736-150831758 GAAGCACTTAGCACAGTGCCGGG + Intronic
1036783833 8:11672101-11672123 GAATCACTTAGTGTGATGCCTGG - Intergenic
1037109755 8:15151962-15151984 GAATCACTTAATATCACGTCAGG - Intronic
1037159797 8:15755300-15755322 AAATCACTTAGCACATTGCCTGG + Intronic
1037507669 8:19547980-19548002 GAATCACTTAATACAATGCCGGG - Intronic
1038398332 8:27263497-27263519 AAATCACTTAGAACATTGCCTGG + Intergenic
1038682048 8:29677788-29677810 GAACCACTTAGCACAATGCCTGG - Intergenic
1038778307 8:30550376-30550398 TAAACACTTAAGAGAATGCCCGG + Intronic
1038806086 8:30793113-30793135 GGACCACTTGATACAATGCACGG + Intronic
1039188795 8:34948336-34948358 GAAGCACTTAGAACAGTGCCTGG - Intergenic
1039435728 8:37557962-37557984 CAATCACCTAAAACAGTGCCTGG + Intergenic
1039589194 8:38732623-38732645 GAAGCACTTAGCACAATGCCTGG - Intronic
1041544953 8:59032620-59032642 GAAGCACCTAACACATTGCCTGG - Intronic
1041738862 8:61138491-61138513 GAAACGCTTAAAACAGTGCCTGG - Intronic
1042648393 8:71012641-71012663 GAAGTACTTAGTACAATGCCTGG - Intergenic
1043312537 8:78878546-78878568 GAATCATGTAATATAATACCAGG - Intergenic
1043517840 8:81012798-81012820 GCATCACACAATACAATGTCTGG - Intronic
1044418763 8:91967154-91967176 AAAGCACTTCATACCATGCCTGG + Intronic
1044699856 8:94956185-94956207 TAAGCATTTAATACAATGCTTGG + Intronic
1044833171 8:96269943-96269965 AAAGCACTTAAAACAGTGCCTGG - Intronic
1044871262 8:96622140-96622162 AAAGCACTTAGAACAATGCCTGG + Intergenic
1045407719 8:101883530-101883552 GAACAAATTAATACAAAGCCTGG + Intronic
1046029887 8:108770842-108770864 GAATCACTGAATCCTAGGCCTGG + Intronic
1046366922 8:113245846-113245868 GAATAAATTAATACATTTCCAGG - Intronic
1046812163 8:118544876-118544898 GAAGCACCTAGCACAATGCCTGG - Intronic
1046898310 8:119496984-119497006 AAACCTCTTAAGACAATGCCAGG - Intergenic
1047774144 8:128055462-128055484 AATGCACTTAATACACTGCCTGG + Intergenic
1048075150 8:131061875-131061897 TAATGTCTGAATACAATGCCTGG - Intergenic
1048823695 8:138402527-138402549 GAATCACTGAATGCAAGGTCTGG - Intronic
1050073273 9:1838715-1838737 GAATGACTAAAAACAGTGCCTGG - Intergenic
1050379946 9:5018125-5018147 AAATCAATTAATAAAATGACAGG - Intronic
1051025594 9:12607114-12607136 GAAACACTTAAAGCAGTGCCTGG + Intergenic
1051093794 9:13441380-13441402 AAAGCACTTAAAACAATGGCTGG - Intergenic
1051201987 9:14636020-14636042 AAATCAATTAATAAAATGACAGG + Intronic
1051202644 9:14645439-14645461 GAATCACAAAATTCAATTCCAGG + Intronic
1051593273 9:18797789-18797811 AAAGCACTTAACCCAATGCCAGG + Intronic
1051612690 9:18976938-18976960 GAAGCACTTAGCACAATGCCTGG + Intronic
1052075244 9:24133641-24133663 GAATGACGTAATACAGTTCCTGG + Intergenic
1052215159 9:25958010-25958032 AAATCAATTAATAAAATGACAGG + Intergenic
1052531856 9:29695257-29695279 TATTAACTTAATTCAATGCCTGG + Intergenic
1052629709 9:31021692-31021714 TAATCACTCAACATAATGCCAGG + Intergenic
1053396940 9:37784198-37784220 AAATCACTTCATAAAGTGCCGGG + Intronic
1055275077 9:74606139-74606161 AAATCTCTTAACACAATGCCTGG + Intronic
1055377737 9:75668222-75668244 ATAGCACTTAATACAGTGCCTGG + Intergenic
1056055183 9:82814543-82814565 CAATAAGTTAATAGAATGCCTGG - Intergenic
1056616616 9:88173104-88173126 GAAACACTCAGCACAATGCCTGG - Intergenic
1058425663 9:104873756-104873778 GAAGCACTTAGTACAGTGCCTGG - Intronic
1058526772 9:105866917-105866939 GGAGCATTTAGTACAATGCCTGG - Intergenic
1058545548 9:106057728-106057750 GAAACACTTAGCACAATGCCTGG - Intergenic
1058729060 9:107832471-107832493 GGAGCACTTGGTACAATGCCTGG + Intergenic
1059225816 9:112672061-112672083 AAAGCACTTAAAACAATGCCTGG + Intergenic
1059661972 9:116410562-116410584 GAAGTACTTAATTCCATGCCAGG - Intergenic
1059814001 9:117891326-117891348 GAAGCATTTAGTACAGTGCCTGG + Intergenic
1059867647 9:118534245-118534267 TTATCACTTAATACAATTCCTGG - Intergenic
1059871514 9:118583429-118583451 GAATCAGTCAATACGATGCAAGG - Intergenic
1060196155 9:121624860-121624882 GAAGCATTTAACACAGTGCCAGG + Intronic
1061067723 9:128289067-128289089 AAAGCACTTAGCACAATGCCTGG - Intergenic
1061353905 9:130088593-130088615 GAAGCACTTAGCACAATGCCTGG - Intronic
1186639343 X:11438476-11438498 TAATCACTTAAAACACAGCCAGG + Intronic
1186995625 X:15118543-15118565 AAAACACTTAGAACAATGCCTGG + Intergenic
1187314343 X:18178679-18178701 AAAGCTCTTAACACAATGCCTGG - Intronic
1188402374 X:29761644-29761666 GAAACACTTAGAACATTGCCTGG + Intronic
1188832262 X:34913483-34913505 GAATCACTAATTCTAATGCCAGG - Intergenic
1188960982 X:36491083-36491105 GTAGTACTTAGTACAATGCCAGG - Intergenic
1189036163 X:37495489-37495511 AAATCACTTAGAGCAATGCCTGG + Intronic
1189216079 X:39325248-39325270 AAAGCACATAACACAATGCCTGG + Intergenic
1189795587 X:44642935-44642957 AAAGCACTTAGAACAATGCCTGG + Intergenic
1191044173 X:56118271-56118293 AAAGCACTTAATACAATATCTGG + Intergenic
1191235856 X:58133195-58133217 GTATCTATTATTACAATGCCTGG - Intergenic
1191248098 X:58243951-58243973 ATATCACTCATTACAATGCCTGG - Intergenic
1192126066 X:68502017-68502039 AACACACTTAATAGAATGCCTGG + Intronic
1192270188 X:69571838-69571860 GAATCTCTTATCACACTGCCTGG + Intergenic
1192594044 X:72387684-72387706 AAAGCACTTAAAACAGTGCCAGG + Intronic
1192676928 X:73207323-73207345 CAAGCACTTAGCACAATGCCTGG - Intergenic
1193144226 X:78060901-78060923 AAAGCACTTATTACAATGTCTGG + Intergenic
1194724566 X:97379431-97379453 AAAACACTTAAGACAAAGCCTGG - Intronic
1195348005 X:103970391-103970413 AAAGCACTTAGAACAATGCCTGG + Intergenic
1195359437 X:104068450-104068472 AAAGCACTTAGAACAATGCCTGG - Intergenic
1195778156 X:108430885-108430907 AAAACACTTAAAACAGTGCCTGG - Intronic
1196423491 X:115545931-115545953 AAACCACCTAATACAGTGCCTGG - Intergenic
1196718675 X:118833537-118833559 GAAACACATATTACAATGTCTGG + Intergenic
1197325230 X:125084573-125084595 GAACCACTTAATTCATTGCCTGG - Intergenic
1197929054 X:131677311-131677333 AAAACACTTATGACAATGCCTGG - Intergenic
1198762595 X:140048781-140048803 AAAACACTTAAAACAGTGCCTGG - Intergenic
1199107996 X:143894908-143894930 GAATCATTTAGCACAGTGCCTGG - Intergenic
1199243577 X:145576162-145576184 AAAGCACTTAGTACAGTGCCTGG + Intergenic
1199655576 X:149991745-149991767 GAAGCACTTAAAACAAGGCCTGG + Intergenic
1199659725 X:150036914-150036936 AAAACACTTAATACGATGCATGG - Intergenic
1199804115 X:151280825-151280847 AAATCACTTAGATCAATGCCTGG + Intergenic
1200778502 Y:7192670-7192692 GAATCTCTGAATACAATAACAGG - Intergenic
1202016366 Y:20410911-20410933 GAGTCTCTTAATACAATTTCTGG + Intergenic
1202053537 Y:20805543-20805565 GAATCAATTAATACATAGCTAGG + Intergenic