ID: 1037510619

View in Genome Browser
Species Human (GRCh38)
Location 8:19578165-19578187
Sequence AGGGGGATAGAATTTGATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 206}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037510619 Original CRISPR AGGGGGATAGAATTTGATGA TGG (reversed) Intronic
901705832 1:11072395-11072417 AGAGGGATTGAATGAGATGATGG - Intronic
903674392 1:25055092-25055114 AGCGGGAGAGAATCTGATGCAGG + Intergenic
904870845 1:33617131-33617153 AGGGAGAGAGAATTTGGGGAAGG + Intronic
907166656 1:52417538-52417560 AGGGGCAGAGAATTAGAGGATGG + Exonic
907404474 1:54245426-54245448 AGGGGGACAGAATGGGAAGATGG + Intronic
907405221 1:54249924-54249946 AGGAGGATGGAATCTGAGGAGGG - Intronic
910955180 1:92695629-92695651 AGGGGGAAAGAATGTGAAGTTGG + Intronic
911091570 1:94021543-94021565 GGAGGGATGGAATTTAATGAAGG + Intronic
912422974 1:109558831-109558853 AGGGGAATAGGACTTGTTGAAGG + Intronic
916239362 1:162623672-162623694 AGGGGGATAGAAAATGGTAATGG + Intergenic
916984546 1:170176710-170176732 AGGGGGATTGAAATTCATGGGGG + Intergenic
917499860 1:175576307-175576329 AGGTGGAGAGAATTTGAGCAAGG + Intronic
919185575 1:194143470-194143492 AAAGGGAGAAAATTTGATGAAGG - Intergenic
919878393 1:201886998-201887020 AGGGGTATACACTTTGAGGAGGG + Intergenic
919878398 1:201887031-201887053 AGGGGTATACACTTTGAGGAAGG + Intergenic
922064036 1:222118678-222118700 AGGGGAATAGATGTTGATAAAGG - Intergenic
1063253719 10:4303182-4303204 AGGGAGATAGCATGTGATGACGG - Intergenic
1064963169 10:20988587-20988609 AGAGAGAGACAATTTGATGATGG - Intronic
1066076298 10:31881044-31881066 AGGGGGATAGAGATGGAGGAGGG - Intronic
1066438751 10:35417482-35417504 AGGGAAAGAGAAGTTGATGATGG + Intronic
1068939832 10:62669935-62669957 AGTGGGAGAGGATTTAATGAAGG - Intronic
1069062251 10:63906375-63906397 AGGGGGAAAGAGTCTGCTGATGG + Intergenic
1069151002 10:64959626-64959648 AGGGGCATAGAAAATAATGAGGG + Intergenic
1070326764 10:75394958-75394980 AGGGGGATAAGATTGGATGGTGG + Intergenic
1070410727 10:76137484-76137506 AGGTAGATGGAATTTGCTGATGG + Intronic
1071555535 10:86598623-86598645 AGGGGTATGGCATTTGGTGAAGG + Intergenic
1072142657 10:92603219-92603241 AGGGGGATAGGAAGTGTTGAGGG - Intronic
1072293758 10:93990758-93990780 AGGGGAACAGAATTTGGTGTGGG - Intergenic
1074186213 10:111101370-111101392 AGTTGGGTAGAATGTGATGATGG + Intergenic
1074626672 10:115197445-115197467 TGGTTGATAGAATTTGATCAGGG + Intronic
1076285835 10:129295655-129295677 AGCAGGCTAGAATTTGATGCTGG + Intergenic
1080906218 11:36548056-36548078 AGGGGTGTTGAATTTTATGAAGG - Intronic
1080921921 11:36717669-36717691 AGGGGCACAGAATTTGGTGGAGG + Intergenic
1081286463 11:41276093-41276115 AGGTGGATAGAATGTTATGTTGG - Intronic
1081387372 11:42487510-42487532 AGGGGGATATAATTGAATCATGG + Intergenic
1081729233 11:45357270-45357292 AAGCGGATCGAATTTGTTGATGG - Intergenic
1082262002 11:50083575-50083597 AGAGGGAGAGAATTAGAGGACGG - Intergenic
1083568934 11:63745411-63745433 AAGGGAATAGAAAGTGATGAAGG + Intronic
1084219170 11:67667066-67667088 AGGGGTCTAGAATTTGAGGAGGG + Intronic
1084911716 11:72395015-72395037 AGGGGGAGAGCATTTGCAGAAGG - Intronic
1085039397 11:73317986-73318008 AGGGGGATGGAACTTATTGAAGG - Intronic
1085662071 11:78377448-78377470 AGTGTGATAGAATTTGGAGATGG - Intronic
1086311499 11:85540477-85540499 AGGGGGATGGAATGGGATGGTGG - Intronic
1087906412 11:103703157-103703179 AGAGGAAAAGAATATGATGAGGG - Intergenic
1088066089 11:105721232-105721254 AGGTGGAAAGATTTTGAAGAGGG + Intronic
1089182568 11:116593180-116593202 TGGGGGATAGGAATTGATGGGGG + Intergenic
1090856676 11:130614842-130614864 AGGGGGACAGCATTTGCTCAAGG + Intergenic
1092041897 12:5392750-5392772 AGAGTGAAAGAAATTGATGAGGG - Intergenic
1093076297 12:14761715-14761737 AGGGGGAGATAATTTAATCATGG + Intergenic
1095657674 12:44689471-44689493 AGAGAGATATAATATGATGATGG - Intronic
1095879108 12:47113515-47113537 AGGGGAATAGGATTTGAAGCAGG - Intronic
1097703251 12:62841753-62841775 AAGGGGATAGAAGTTAGTGATGG - Intronic
1097995268 12:65881681-65881703 AGGAGGAGAGAAATTGCTGAAGG + Intronic
1100276657 12:93077614-93077636 AGTGGGAGATAATTTGATCATGG - Intergenic
1100906559 12:99306522-99306544 AGGGGGATAGTTTCTGATGATGG + Intronic
1103890578 12:124235773-124235795 AGGAGCACAGAAGTTGATGACGG - Intronic
1104294694 12:127501292-127501314 AGGCAGATAGCAATTGATGAAGG + Intergenic
1105790141 13:23790589-23790611 AGGGGGAGGCAATGTGATGAGGG + Intronic
1107266416 13:38561249-38561271 AGGGAGATAGAATATGAAGTTGG - Intergenic
1109037887 13:57289020-57289042 ACGGGGTAAGAATTTAATGATGG - Intergenic
1109686816 13:65831067-65831089 AGGAGGAAAGGATGTGATGAGGG - Intergenic
1111413805 13:87912450-87912472 AGGGGGATGGAAGGGGATGATGG - Intergenic
1111960320 13:94802945-94802967 GGGGTGATAGTATTTTATGATGG - Intergenic
1112286669 13:98111100-98111122 AGAGTGATAGTATTTGAAGAGGG - Intergenic
1112898875 13:104335599-104335621 AGGTGAAAAGAACTTGATGATGG - Intergenic
1115012930 14:28572582-28572604 AGGGGGATAGAGTGGGATGGTGG + Intergenic
1115130237 14:30046049-30046071 AGGGGGAGATAATTTAATCATGG - Intronic
1115859520 14:37668456-37668478 AGGGGGATAAAATTGCATGGAGG - Intronic
1116990272 14:51268630-51268652 AGGAGTATATACTTTGATGAGGG + Intergenic
1117257477 14:53993369-53993391 AAGGAGACAGAATTTGAAGAAGG + Intergenic
1117476444 14:56100070-56100092 AATGGGATAGAATTTAATGACGG + Intergenic
1130857338 15:87852361-87852383 AGGGCCAGAGAATTTGATGTGGG + Intergenic
1132331162 15:101013301-101013323 AGGAGGAGAGAATTTAATGTGGG + Intronic
1134336888 16:13308581-13308603 AGTGGGATAGAATTGGAGGGAGG - Intergenic
1135784039 16:25331972-25331994 AGGTGGAGAGAATTTAATTATGG + Intergenic
1137712173 16:50574129-50574151 TGGGTGATAGAACTTGATGCTGG + Intronic
1137978338 16:53049493-53049515 AGGGGCATAGAATCTGCTGGAGG + Intergenic
1139265735 16:65636578-65636600 AGGAGGAGAGAAATTGAAGAAGG + Intergenic
1139377958 16:66512419-66512441 AGGAGGGTAGAAAGTGATGAGGG - Intronic
1140136446 16:72210084-72210106 AGGTGGATGGAATTTAAGGAAGG - Intergenic
1140197603 16:72868285-72868307 AGTGGGAGAGAATAAGATGAAGG - Intronic
1140628361 16:76821975-76821997 AGGGGGAGATAATTTTATCATGG - Intergenic
1140778118 16:78268900-78268922 AGAGGGATAGAATTAGATGAAGG - Intronic
1143578233 17:7807662-7807684 AGGGGGCTAGAATTAGATGGGGG - Intronic
1146699661 17:34945518-34945540 AGGGCAATAGGATTTGTTGAGGG - Intronic
1146826271 17:36025679-36025701 AAAGGGATAGCATTTGATGCAGG + Intergenic
1146948466 17:36890012-36890034 AGGGGGATTGCATCTGAGGAGGG - Intergenic
1148161056 17:45450375-45450397 AGGAGGAAAGAGTTTGAGGATGG - Intronic
1148524326 17:48316057-48316079 AGGGGGATAGGAGTGGAAGAGGG - Intronic
1148972415 17:51495564-51495586 ATGGGTATAGAATTTTATGTTGG + Intergenic
1149019116 17:51943148-51943170 AGAGGTATAGAATTTGACTATGG - Intronic
1150392288 17:64797021-64797043 AGGAGGAAAGAGTTTGAGGATGG - Intergenic
1155346561 18:24862914-24862936 AAGGGGTTAGGATTTGGTGAGGG + Intergenic
1157124470 18:44942935-44942957 AGGGTGACAGAATATGAGGATGG + Intronic
1159790946 18:72778142-72778164 AGGGGGACAGAATGAGTTGAAGG - Intronic
1161875949 19:6909687-6909709 AGGGGGACAGAATTGGTTGGTGG + Intronic
1164757841 19:30703455-30703477 TGTGAGATAGAATTTGATGTGGG - Intronic
1165451256 19:35884782-35884804 AGTGGGGTAGTATTTGAAGATGG - Intergenic
1165470983 19:36004473-36004495 AGGGGGATTGTATTGGATAAAGG - Intronic
1166050657 19:40256947-40256969 AGGGGGGTAGAGTCTGATCAGGG + Exonic
1166652927 19:44588585-44588607 AGGGGGAAGGAATTAGATGAGGG - Intergenic
1166870480 19:45867387-45867409 AGGGGGAATGGATTTGTTGAAGG + Intronic
1168445491 19:56408703-56408725 AGGGTGGTAGAAAATGATGAGGG + Intronic
925258334 2:2508157-2508179 ATAGGGCTAGAATATGATGAAGG + Intergenic
927249129 2:20982404-20982426 AGAGGGATAGCATATGATCAAGG - Intergenic
929874775 2:45787314-45787336 AGTAGGATAAAATGTGATGAGGG + Intronic
931511874 2:63006261-63006283 AGTGGCATAGAATGGGATGATGG - Intronic
932136001 2:69229132-69229154 AGTGGGATAGTATTTGAGGGTGG - Intronic
932999349 2:76902551-76902573 TGGGGGATAGAACTAGAAGATGG + Intronic
934667222 2:96180791-96180813 AGGGCTATAGAATTAGATGAAGG + Intergenic
936549068 2:113419324-113419346 AGGGAGATAGAGTAGGATGATGG + Intergenic
939450819 2:142372110-142372132 AGTGGGTGAAAATTTGATGAAGG + Intergenic
940370914 2:152899800-152899822 AGGGGTGTAGAATTTTATCAAGG - Intergenic
941512221 2:166425908-166425930 AAGGGGATAGAATGTGAAGCTGG + Intronic
941704514 2:168643728-168643750 AGAGTGATAGATTTTGAAGATGG - Intronic
943111987 2:183618194-183618216 AGGGGTATTGAATTTATTGAAGG + Intergenic
943473824 2:188329815-188329837 ATGGGGACAGGATTTGCTGATGG + Intronic
946912607 2:224480075-224480097 TGGGGGATGGAATTTGAGAAAGG + Intronic
1169359670 20:4937429-4937451 AGAGGGATAGAAGATCATGATGG + Intronic
1172211812 20:33204833-33204855 AAAGTGATAGAATTTGAAGAAGG + Intergenic
1173185856 20:40839639-40839661 AGGGGGAAAGGAGTTGATGGAGG + Intergenic
1173487717 20:43453815-43453837 AGTGGGATAGTATTTATTGAAGG + Intergenic
1179049145 21:37873974-37873996 ATGGAGATAGAAGTTGAAGAGGG - Intronic
1180885386 22:19239848-19239870 CGGGGGTAAGAATCTGATGAGGG + Intronic
1181903771 22:26176891-26176913 AGAGGGATAAAATGTGATAAGGG - Intronic
1183147111 22:36003449-36003471 AGGGGGAAAAAATTAGATGTAGG + Intronic
950328515 3:12136641-12136663 AGGTGGATGGGAATTGATGAAGG + Intronic
950476420 3:13218012-13218034 GGGGGGCTAGCATGTGATGATGG - Intergenic
951488004 3:23235678-23235700 AGGTGGACAGGATTTGCTGATGG + Intronic
952472073 3:33665755-33665777 AAGTGTATAGAGTTTGATGATGG - Intronic
954651621 3:52167724-52167746 TGAGGGATAGAATTTGGTCAAGG + Intergenic
959850963 3:111086368-111086390 AGCGGGAAAAAATTTCATGATGG - Intronic
960909498 3:122634899-122634921 AGAGGAAGAGAATTTGGTGAAGG - Intronic
961080407 3:124022263-124022285 GGAGGGATAGCATTAGATGACGG - Intergenic
962021881 3:131510461-131510483 TGGGGGATAGATTTTCACGATGG + Intergenic
964652642 3:159028587-159028609 AGGAGGACAGAAGTTGATAAGGG + Intronic
965888769 3:173483352-173483374 GAGGGGGTAGAATTTCATGAAGG + Intronic
967447779 3:189586774-189586796 AGGGGGAGAAAATTTCAGGAAGG - Intergenic
967839545 3:193994155-193994177 AGGGGGGAAGTAGTTGATGAGGG - Intergenic
968190691 3:196665113-196665135 AAGGGGACAGAATTTGCTGGGGG - Intronic
970744300 4:19276514-19276536 AGGAGGAAAGTATTTGTTGAAGG - Intergenic
971348216 4:25831427-25831449 AGGGAGATAGCATTTTATGCTGG - Intronic
972394767 4:38649371-38649393 AGGGGGATAGAATGTGAAGGTGG - Intergenic
973918207 4:55657757-55657779 AGTGGGCTAGAATATGCTGAAGG + Intergenic
974247102 4:59333894-59333916 GAGGGGCTAGAATTTGGTGAGGG - Intergenic
974310410 4:60200991-60201013 ATGGCGATAGAAGTTAATGAAGG + Intergenic
975490879 4:74987109-74987131 AGGGGAAGCCAATTTGATGATGG - Intronic
976442857 4:85096158-85096180 AGGGGGAAAGAAATGGAAGAAGG - Intergenic
977669418 4:99678661-99678683 AGGTGGAGAGAAGTTGATTAAGG - Intergenic
978495026 4:109349543-109349565 AGGGGGATAGAATTTGTATTTGG - Intergenic
980042953 4:127960833-127960855 AAAGGGATAGAATTTGGTGGGGG - Intronic
980106970 4:128597243-128597265 AGGATGATTGAATATGATGAAGG + Intergenic
981091287 4:140735084-140735106 AGGTTGAAAGAATTTGATAAAGG - Intronic
981606799 4:146548209-146548231 AGGGGCATAGAGTTTGATGAAGG + Intergenic
982793911 4:159623274-159623296 AGGGAGATTGAAATTGATGAAGG + Intergenic
983640446 4:169940165-169940187 AGGTGGATATAATTGGATCATGG + Intergenic
985131360 4:186741523-186741545 TGGGCTATAGAATTAGATGATGG - Intergenic
985193633 4:187404609-187404631 AGGGGTGTTGAATTTCATGAAGG + Intergenic
987560058 5:19508316-19508338 AGGGATAGAAAATTTGATGATGG - Intronic
987856045 5:23422221-23422243 AAGGGGAAAGAAAGTGATGAGGG + Intergenic
988337539 5:29925964-29925986 AGTGGGAGAGAATTGAATGATGG + Intergenic
988855083 5:35220481-35220503 AAGGGAATAGAGTTTGCTGAAGG - Intronic
989673819 5:43950790-43950812 AGGGAGATTGTATTTTATGAGGG + Intergenic
993417266 5:87650515-87650537 AAGGGTAAAGAATTTGATGGTGG - Intergenic
994926700 5:106125146-106125168 AGAGGGAAATAATTTGATAATGG - Intergenic
995437802 5:112157687-112157709 AGGGGGATAAAAATGGAAGAAGG - Intronic
995989103 5:118213957-118213979 AGGTGGATTGAACTTGATGTGGG - Intergenic
996966248 5:129309488-129309510 AGGGGGATGGATTTTGAGGAGGG + Intergenic
996969337 5:129344530-129344552 AGTGGGATAGAATTTTGTGAGGG + Intergenic
997197813 5:131991377-131991399 AGGGGCATAGCAGTAGATGATGG - Intronic
998984947 5:147746295-147746317 TCTGGGAGAGAATTTGATGAGGG - Intronic
999633251 5:153593312-153593334 AGTGGGATAGGATTAGAAGATGG - Intronic
1004457214 6:15802262-15802284 ACGGGGTTAGAATTTTAAGATGG - Intergenic
1004548419 6:16622222-16622244 AAGGGGATAAAAACTGATGAGGG + Intronic
1005913675 6:30332859-30332881 AGGGGCATTGAGTCTGATGAGGG - Intronic
1007316137 6:40990644-40990666 AGAGGGAGAGGAGTTGATGATGG - Intergenic
1011253019 6:85392977-85392999 ATGGGGAGAGAAGTTGCTGAAGG + Intergenic
1014050211 6:116943720-116943742 AGGGGGATGAGATTGGATGAGGG + Intergenic
1014166818 6:118234236-118234258 AAGGGGAGAGAATTTCATAAGGG - Intronic
1015503434 6:133956562-133956584 AGGGACATACAATATGATGATGG - Intronic
1018026425 6:159810031-159810053 AGTGGGACATAATATGATGATGG + Exonic
1021487953 7:21187620-21187642 AGTGGGATAGTATTTGGAGAGGG + Intergenic
1022356294 7:29617734-29617756 AGGGGAATTGAGTTTGAGGATGG - Intergenic
1022491157 7:30819665-30819687 AGGAGCATAGAGTTTCATGATGG + Intronic
1022518412 7:30989832-30989854 GGCTGGATAGAATTTGAGGAAGG + Intronic
1023283479 7:38594940-38594962 GGGGGGAAAGAATTTTAAGACGG + Intronic
1024788431 7:52934579-52934601 TAGGTGATAGAATTTGGTGATGG + Intergenic
1030424933 7:109363919-109363941 AAGGGGATGGCATTTGATGAGGG - Intergenic
1032148732 7:129408855-129408877 AGGGGTATAGAGTTTTAAGAAGG + Intronic
1037510619 8:19578165-19578187 AGGGGGATAGAATTTGATGATGG - Intronic
1039867000 8:41513718-41513740 AGGGGGAAAGAAGCTGGTGAAGG - Intergenic
1040476232 8:47780594-47780616 AGGAGGAGAGAATTTTAAGATGG - Intronic
1041358701 8:57027968-57027990 AGGGAAATAGAAATTGATGTGGG + Intergenic
1041870942 8:62633808-62633830 AGGGGGAAAGAATATGAAGAAGG + Intronic
1048389156 8:133944791-133944813 AGGGGCCTAGAATTAGAAGAGGG + Intergenic
1048689569 8:136945948-136945970 TGGAGCATAGAATATGATGATGG - Intergenic
1049903874 9:197526-197548 AGGGAGATAGAGTAAGATGATGG - Intergenic
1050196130 9:3086351-3086373 AGGGGTCTGGAATTTCATGAGGG - Intergenic
1051535486 9:18152635-18152657 AGGGGGAGAGATTTTCAAGAAGG + Intergenic
1051685227 9:19651559-19651581 AGAGAGAAAGAAATTGATGATGG - Intronic
1052324976 9:27207988-27208010 AGGGGTGTAGAATCTTATGAAGG + Intronic
1052334580 9:27306602-27306624 AGGGAGATAGAATATGAGGCTGG - Intergenic
1052571871 9:30235936-30235958 AGTGTGATAGAAGTTGATGGTGG - Intergenic
1053746880 9:41207825-41207847 AGGGAGATAGAGTAGGATGATGG - Intergenic
1054480404 9:65657534-65657556 AGGGAGATAGAGTAGGATGATGG + Intergenic
1054681464 9:68223456-68223478 AGGGAGATAGAGTAGGATGATGG + Intergenic
1055087557 9:72329500-72329522 AGGGGAACAGACTTTCATGAAGG - Intergenic
1055143315 9:72901823-72901845 AAGGGGATAGAAATTGATCATGG + Intronic
1055662195 9:78515780-78515802 AGTGGGATAGAAAGTGCTGACGG + Intergenic
1060450025 9:123729047-123729069 AGGGGGGTTGAATTTGTTGAAGG - Intronic
1202783011 9_KI270718v1_random:18605-18627 AGGGAGATAGAGTAGGATGATGG - Intergenic
1185544631 X:933793-933815 ACGTGGAGAGAATTTGATGACGG - Intergenic
1186595124 X:10972874-10972896 AGAGGGAGAGAATTTGAGGTTGG - Intergenic
1189012382 X:37059541-37059563 AAGGTGATAGTATTTGAAGATGG - Intergenic
1189036331 X:37496711-37496733 AAGGTGATAGTATTTGAAGATGG + Intronic
1189605266 X:42671258-42671280 TGAGGGATAGAACTTGATGCAGG + Intergenic
1190302628 X:49065414-49065436 AGTGGGATAGAATTCAATGAGGG - Intronic
1191116300 X:56856988-56857010 AGGGGGAGATAATTGGATCATGG - Intergenic
1191975116 X:66863096-66863118 AGGGGCATAGAATTTGAGATGGG - Intergenic
1194375359 X:93126029-93126051 AGGGGGATGGAATCTTCTGAAGG + Intergenic
1194865038 X:99054785-99054807 AAGGTGATGGAATTTGAAGATGG - Intergenic
1194958709 X:100211008-100211030 AGGGGTGTTGAATTTGTTGAAGG + Intergenic
1195406047 X:104514482-104514504 AGGGGGATGGTATTTGGAGATGG - Intergenic
1195877749 X:109559844-109559866 AGGGGGATAGAAAGTGCTGAAGG - Intergenic
1196939050 X:120757803-120757825 ATGGGGATCTAATTTGAGGAAGG + Intergenic
1197904083 X:131405255-131405277 AGGTGAGTAGAGTTTGATGAAGG + Intergenic
1197959402 X:131987833-131987855 AGAGAGATAGAATTTGCTGGGGG - Intergenic