ID: 1037511875

View in Genome Browser
Species Human (GRCh38)
Location 8:19591512-19591534
Sequence CCGTGTAACAAAGATTAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037511871_1037511875 7 Left 1037511871 8:19591482-19591504 CCATCTTCAATTTATTCAACTGA 0: 1
1: 0
2: 2
3: 32
4: 401
Right 1037511875 8:19591512-19591534 CCGTGTAACAAAGATTAGGTAGG No data
1037511870_1037511875 30 Left 1037511870 8:19591459-19591481 CCTTTTTGGGCGTTTATATTCAT 0: 1
1: 0
2: 1
3: 23
4: 172
Right 1037511875 8:19591512-19591534 CCGTGTAACAAAGATTAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037511875 Original CRISPR CCGTGTAACAAAGATTAGGT AGG Intronic
No off target data available for this crispr