ID: 1037512188

View in Genome Browser
Species Human (GRCh38)
Location 8:19594793-19594815
Sequence CTGTGGAAGGCCAAGGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 265827
Summary {0: 8, 1: 1133, 2: 25627, 3: 79568, 4: 159491}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037512188_1037512197 11 Left 1037512188 8:19594793-19594815 CCACCCACCTTGGCCTTCCACAG 0: 8
1: 1133
2: 25627
3: 79568
4: 159491
Right 1037512197 8:19594827-19594849 TAGGCATGAGCCACCACACCCGG 0: 692
1: 8532
2: 37449
3: 100599
4: 176994
1037512188_1037512195 -8 Left 1037512188 8:19594793-19594815 CCACCCACCTTGGCCTTCCACAG 0: 8
1: 1133
2: 25627
3: 79568
4: 159491
Right 1037512195 8:19594808-19594830 TTCCACAGTGCAGGGATTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037512188 Original CRISPR CTGTGGAAGGCCAAGGTGGG TGG (reversed) Intronic
Too many off-targets to display for this crispr