ID: 1037515378

View in Genome Browser
Species Human (GRCh38)
Location 8:19625778-19625800
Sequence CAGAACAAGGAGTTTGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037515374_1037515378 1 Left 1037515374 8:19625754-19625776 CCTTAAGGCAAGTGGAAAATCCT 0: 1
1: 0
2: 1
3: 18
4: 172
Right 1037515378 8:19625778-19625800 CAGAACAAGGAGTTTGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037515378 Original CRISPR CAGAACAAGGAGTTTGAGGC TGG Intronic
No off target data available for this crispr