ID: 1037515462

View in Genome Browser
Species Human (GRCh38)
Location 8:19626960-19626982
Sequence GTGAAATGTACAACCACTAA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037515460_1037515462 1 Left 1037515460 8:19626936-19626958 CCCTCACACATTGCTGGTGGGAA 0: 14
1: 126
2: 563
3: 1336
4: 2365
Right 1037515462 8:19626960-19626982 GTGAAATGTACAACCACTAACGG No data
1037515461_1037515462 0 Left 1037515461 8:19626937-19626959 CCTCACACATTGCTGGTGGGAAT 0: 10
1: 140
2: 588
3: 1445
4: 2506
Right 1037515462 8:19626960-19626982 GTGAAATGTACAACCACTAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037515462 Original CRISPR GTGAAATGTACAACCACTAA CGG Intronic
No off target data available for this crispr