ID: 1037522869

View in Genome Browser
Species Human (GRCh38)
Location 8:19697280-19697302
Sequence GTCTTACTGACCCTGAACTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037522868_1037522869 -4 Left 1037522868 8:19697261-19697283 CCATAGAGGCAGTTTCATGGTCT No data
Right 1037522869 8:19697280-19697302 GTCTTACTGACCCTGAACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037522869 Original CRISPR GTCTTACTGACCCTGAACTG AGG Intronic