ID: 1037523890

View in Genome Browser
Species Human (GRCh38)
Location 8:19706303-19706325
Sequence ATACAGATACAGATTGAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 243}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037523890_1037523891 12 Left 1037523890 8:19706303-19706325 CCAGGCTCAATCTGTATCTGTAT 0: 1
1: 0
2: 3
3: 13
4: 243
Right 1037523891 8:19706338-19706360 AATTTCCTCCACATCCTCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037523890 Original CRISPR ATACAGATACAGATTGAGCC TGG (reversed) Intronic
902312262 1:15590206-15590228 ATAAAAATCCAGATTGGGCCAGG + Intronic
905577387 1:39056186-39056208 ATACAAATACAAAATTAGCCGGG + Intergenic
906524084 1:46484497-46484519 TTACATATACAGATTCAGGCCGG + Intergenic
908242894 1:62202842-62202864 CTACAAATACAGATTTAGCTGGG - Intronic
914934262 1:151964496-151964518 ATACAGGAACAGAGTAAGCCAGG + Intergenic
915579733 1:156806210-156806232 AGACAGAAACAGAAGGAGCCTGG + Intergenic
919684000 1:200464700-200464722 AAATAGCTACAGATTTAGCCAGG + Intergenic
919954251 1:202396820-202396842 TTAGAGATAAAAATTGAGCCTGG - Intronic
920137395 1:203781029-203781051 CTACAAATACAGAATTAGCCGGG + Intergenic
1063443672 10:6094133-6094155 ATACAGAAACAAAATTAGCCAGG - Intronic
1064625512 10:17257676-17257698 ATACAGAGACAGAGAGAGACAGG + Intergenic
1065126167 10:22576488-22576510 TTACAGCTACAGCTTTAGCCGGG + Intronic
1065880341 10:30032047-30032069 TTAAAAATACAGATGGAGCCGGG - Intronic
1067730620 10:48808596-48808618 ATGCATATACAGGTTGAGCAAGG - Intronic
1068513477 10:57995924-57995946 TCACATATCCAGATTGAGCCTGG + Intergenic
1068753570 10:60624490-60624512 ATACAGATTCAAATCGAGCAAGG - Intronic
1069200710 10:65612155-65612177 AGACAGAAACAGCTTGAACCCGG + Intergenic
1071016238 10:81000264-81000286 ATAGATATACAGATGTAGCCTGG - Intergenic
1071056159 10:81510354-81510376 ATACAGAAACAAAATTAGCCAGG - Intergenic
1071490573 10:86133822-86133844 ATACAGAAACGGATGGTGCCTGG + Intronic
1072033170 10:91540485-91540507 ACAGAGATTCAGAATGAGCCTGG + Intergenic
1073005823 10:100323562-100323584 ATAAAGATACAGAGTGAGCCGGG - Intronic
1073910726 10:108340698-108340720 ATACAGATACATATTGTGGTGGG - Intergenic
1074335519 10:112570416-112570438 ATAATGGTAAAGATTGAGCCTGG + Intronic
1074652947 10:115545638-115545660 ATAAAGATTCAGTTTGAGACGGG - Intronic
1075311354 10:121416520-121416542 CTTCAGATACAGCTTGATCCAGG - Intergenic
1076476208 10:130753949-130753971 ATACATATACAGATGGTCCCTGG + Intergenic
1077604252 11:3597191-3597213 ATAAAGATACAGCATGGGCCGGG + Intergenic
1078580759 11:12537913-12537935 ATTCAGATCCAGATGGAACCAGG + Intergenic
1078790755 11:14539686-14539708 ATACAAAAACAGAATTAGCCGGG + Intronic
1079424649 11:20328593-20328615 ATAAAGAAAGAGATTGATCCTGG - Intergenic
1079721564 11:23820829-23820851 ATCCAGCTACAGAATGAGACAGG + Intergenic
1079848100 11:25495742-25495764 ATGCAGATATAGATAGAACCAGG - Intergenic
1081263416 11:40988875-40988897 ATACAAAAACAGAATTAGCCGGG - Intronic
1081780477 11:45707547-45707569 ATACAGGCAAAGACTGAGCCAGG - Intergenic
1084409712 11:68999632-68999654 ATACAGCTACAGATTTTGGCTGG + Intergenic
1084442807 11:69185106-69185128 ATATATATACAGAATTAGCCGGG - Intergenic
1084504694 11:69558028-69558050 ATAATGATACAGATTGGGCGTGG - Intergenic
1085933743 11:81118885-81118907 TTACAGATATATATTAAGCCAGG + Intergenic
1087773722 11:102238887-102238909 ATACAGATACTACTTGAGACCGG + Intergenic
1088213471 11:107481943-107481965 ACAAAGATGCAGACTGAGCCTGG + Intergenic
1089115804 11:116094080-116094102 CTACAGTTACACACTGAGCCTGG + Intergenic
1092501835 12:9055618-9055640 ATACAGATACTGAATGAGGTTGG - Intergenic
1093360426 12:18219768-18219790 ATACAGATACATATTTTCCCAGG - Intronic
1095239735 12:39843248-39843270 ATACTGGTACAGAATGAGTCAGG + Intronic
1095257690 12:40059369-40059391 AAACAGATACACATTGAGTATGG + Intronic
1095981448 12:47976929-47976951 AGACAGACACCGATTGAGTCAGG + Intronic
1096069220 12:48765571-48765593 ATTCAGAGAGAGATTCAGCCAGG - Intergenic
1096709858 12:53447481-53447503 CTAAAAATACAGAATGAGCCAGG + Intergenic
1097171342 12:57115404-57115426 ATTCAGATACATATAGGGCCGGG - Intronic
1098947810 12:76608004-76608026 ATACTGATACAGAGTGATGCAGG + Intergenic
1099360778 12:81697772-81697794 ATGCAGACACTGATTGATCCAGG - Intronic
1100007900 12:89916315-89916337 ATACAGAAACAAAATTAGCCGGG - Intergenic
1101031297 12:100662915-100662937 ATACAAAAACAAAATGAGCCGGG + Intergenic
1101547187 12:105726164-105726186 ATACAGAAACAAAATTAGCCGGG + Intergenic
1103263866 12:119612589-119612611 ATACAGAAACAAAATTAGCCGGG + Intronic
1103831926 12:123787097-123787119 ATATAGATACAGATATAGACAGG - Intronic
1103993360 12:124813974-124813996 ATTCAGGTACAGCTTGATCCAGG - Intronic
1105757469 13:23481439-23481461 ATAAAGATACAACTTGAGACTGG - Intergenic
1108554507 13:51579952-51579974 ATACGGATACAGATGCAGGCAGG + Intergenic
1111911413 13:94316420-94316442 ATAAAGAAACAGAATGGGCCGGG + Intronic
1112810917 13:103217483-103217505 ATACAGCTAAAGAATGAGGCAGG + Intergenic
1112916996 13:104564068-104564090 ATGCACATCCAGATTGAGGCCGG + Intergenic
1114389987 14:22297123-22297145 ATACAAATAGGGAGTGAGCCTGG - Intergenic
1114701523 14:24683259-24683281 ATAAAGAGACAGACTGAGCCTGG - Intergenic
1115114838 14:29867698-29867720 GTACAGAGGCAGAATGAGCCAGG + Intronic
1119371012 14:74143251-74143273 TGACAGAAACAGAATGAGCCTGG + Intronic
1120005978 14:79358411-79358433 ATACAGAAACAAAATCAGCCAGG + Intronic
1120087398 14:80289158-80289180 ATACAGATAAAGATAGAGATAGG + Intronic
1120413239 14:84185020-84185042 ATAGAGATACAGATAGAGTTGGG - Intergenic
1120484469 14:85094109-85094131 ATACAGCTAATGAATGAGCCTGG - Intergenic
1120507768 14:85374915-85374937 CTACAGATACAGCTAGATCCAGG + Intergenic
1121063600 14:90939814-90939836 ATAAAGATACACATTTAACCTGG + Intronic
1124635982 15:31365586-31365608 ATACAGGTGCAGCTGGAGCCGGG + Intronic
1125135953 15:36342842-36342864 ATACACATACACACAGAGCCAGG + Intergenic
1125635232 15:41182367-41182389 ATGCATCTTCAGATTGAGCCCGG - Intergenic
1127802113 15:62485750-62485772 ACAGACACACAGATTGAGCCAGG - Intronic
1127942453 15:63713174-63713196 ATACTGATACTGATTCAGCATGG - Intronic
1128191912 15:65709408-65709430 ATTAAGATACATTTTGAGCCGGG + Intronic
1128608782 15:69057847-69057869 AAACAGAGACAGAGGGAGCCAGG - Intronic
1128772591 15:70293274-70293296 ATACAGATATAGAATGAGCCTGG + Intergenic
1130160062 15:81389793-81389815 AAACAGCTACATACTGAGCCAGG + Intergenic
1130608701 15:85340766-85340788 AGAGAGATAGAGATTGAGACTGG + Intergenic
1133553772 16:6885076-6885098 ATACAGAGACAGATCAAACCAGG + Intronic
1134273517 16:12755577-12755599 ATAAAGATACATATTGAGGCAGG - Intronic
1135885800 16:26306321-26306343 ATTCAGGTACAGCTTGATCCAGG + Intergenic
1138001702 16:53287564-53287586 CTAAAGATACAGAATTAGCCAGG + Intronic
1138597985 16:58039484-58039506 ACACAGATACTGTTAGAGCCAGG + Intronic
1138982656 16:62288825-62288847 GTATAGATATAGACTGAGCCAGG - Intergenic
1141306343 16:82867402-82867424 ATACAGAGACAGGATGAGCTTGG - Intronic
1142788707 17:2245975-2245997 ATAAAAATCCAGATTCAGCCAGG - Intronic
1144786198 17:17833126-17833148 ATAAAAATACAGATCCAGCCGGG + Intronic
1145949465 17:28804883-28804905 ATACAGAAACAAAATTAGCCAGG + Intronic
1147365146 17:39954124-39954146 CTAAAGATACAAATTTAGCCAGG + Intergenic
1147493044 17:40889062-40889084 ATCCAGGAACAGATTAAGCCAGG + Intergenic
1149581413 17:57752940-57752962 ATGCAGGTACAGCTTGAGACTGG - Intergenic
1149745419 17:59092987-59093009 CTAAAAATACAAATTGAGCCAGG + Intronic
1152695802 17:81794318-81794340 ACACAGATACATATAGAGACAGG + Intergenic
1153661816 18:7332269-7332291 ATACAGAAACAAAATTAGCCGGG - Intergenic
1159499027 18:69244952-69244974 ATACAGATGCAGATGGACACAGG + Intergenic
1160852362 19:1198811-1198833 ATAAAGAGGCAGAGTGAGCCGGG - Intronic
1161335644 19:3711594-3711616 ATACAAATACAAAATGAGGCCGG + Intronic
1161864450 19:6823732-6823754 ATACAGAAAAAGACTGAGCCTGG - Intronic
1163410919 19:17154109-17154131 ATACATAAACAGCTTGAGGCCGG - Intronic
1163896777 19:20066212-20066234 ATATAGGAATAGATTGAGCCGGG - Intergenic
1164208104 19:23074552-23074574 ATACACTTACAGAATGAACCAGG - Intergenic
1164309985 19:24037111-24037133 CTACAGATACTGATTCAGGCAGG - Intronic
1165545585 19:36532665-36532687 ATACACATACAAAATTAGCCAGG - Intergenic
1167686793 19:50961619-50961641 TTACAGAGACAGATAGAGACAGG - Intronic
1167926954 19:52829019-52829041 ATACAGAAACAAAATTAGCCAGG - Intronic
1167969349 19:53177300-53177322 ATACAGATACAAAATCAGCTGGG + Intronic
926827609 2:16922935-16922957 ACACACATACAGAATGAGCAGGG - Intergenic
927140341 2:20125917-20125939 ATTCAGATAAAGCTTGAGGCTGG - Intergenic
927212061 2:20645108-20645130 AGACAGATACAGATGGGGACAGG - Intronic
928797655 2:35041321-35041343 ATAAAGATACAGCCTGAGACTGG - Intergenic
929801831 2:45111197-45111219 ATTCAGAGACAGATTGAGCACGG - Intergenic
930319110 2:49831987-49832009 ATAAAGATACTGCTTGAGACTGG + Intergenic
930660343 2:54046533-54046555 TGAGAGATACAGATTCAGCCTGG - Intronic
933344247 2:81063580-81063602 ATATGGAGACAGACTGAGCCAGG - Intergenic
934970879 2:98763111-98763133 ATAAAGACACAGATTAGGCCAGG + Intergenic
937184223 2:120024615-120024637 ATACAAAAACAGAATTAGCCGGG - Intronic
937471801 2:122180386-122180408 ATACAGATACAGATTTCGAGAGG + Intergenic
938866849 2:135431284-135431306 TTACATATACACATTGAGACAGG - Intronic
939347247 2:140981460-140981482 ACACAGTAACAGAATGAGCCAGG - Intronic
940955140 2:159719134-159719156 ATACAAAAAAAGATTTAGCCGGG - Intronic
942625074 2:177891755-177891777 ATACATATAAAGAATGAGCATGG - Intronic
944325165 2:198395840-198395862 ATAAAGACACAAAATGAGCCAGG - Intronic
944355042 2:198777878-198777900 ATACAGTAAGAGGTTGAGCCAGG - Intergenic
946811353 2:223529271-223529293 GCACAGAGACAGCTTGAGCCAGG + Intergenic
947001658 2:225464147-225464169 AAACAGAGACCGATTGAGGCAGG + Intronic
947303973 2:228722839-228722861 TGAGAGATACAGCTTGAGCCAGG + Intergenic
948960264 2:241329283-241329305 ATACAGAAACAAAATTAGCCAGG - Intronic
1169456068 20:5753687-5753709 ATACAAATAGAGATTTAACCTGG - Intronic
1174833894 20:53838322-53838344 AAAAAGAAACAAATTGAGCCGGG - Intergenic
1176932989 21:14835657-14835679 ATACATATACAAATTGACACAGG - Intergenic
1177645515 21:23895820-23895842 ATTCAGATTCAGATTCAGACTGG + Intergenic
1178081306 21:29068618-29068640 ATACAGAAACAAAATCAGCCGGG - Intronic
1179251828 21:39677168-39677190 ATACAGCTAGAAATTGACCCTGG + Intergenic
1182160375 22:28115522-28115544 CTCTAGATACAGATTTAGCCAGG - Intronic
1182483653 22:30626437-30626459 CTGCAGAAACAGATTGAGCAAGG - Intronic
1182586921 22:31348830-31348852 ACACAGATAGTGATGGAGCCAGG + Intergenic
1182767959 22:32772363-32772385 ATACAGATGTGGAGTGAGCCTGG + Intronic
1184568395 22:45307347-45307369 ATACACAAATAGATTGAGTCTGG + Intergenic
949588931 3:5473106-5473128 ATAAAAATACAGATTGAGATTGG + Intergenic
950836453 3:15924134-15924156 ATTCAAATTCAGATTTAGCCTGG + Intergenic
951094926 3:18617636-18617658 ATACAGAAACAAATTAAGCATGG - Intergenic
952209900 3:31219874-31219896 CAACAAATACAAATTGAGCCAGG + Intergenic
952235145 3:31471632-31471654 AGCCAGAAACAGAATGAGCCAGG + Intergenic
954046088 3:47931788-47931810 TTAAAAATACAGATGGAGCCAGG - Intronic
954085378 3:48240099-48240121 ATACAGAGACAGAGGGAGCGGGG + Intergenic
954335321 3:49913046-49913068 AGCCAGATGCAGAATGAGCCTGG + Intronic
956028114 3:65005697-65005719 AGACAGATGCAGAATGAGTCAGG - Intergenic
956653356 3:71525958-71525980 ATACAAAAACAAAATGAGCCAGG + Intronic
956656795 3:71560095-71560117 CTTCAGGTACAGATGGAGCCAGG - Intronic
956896484 3:73665999-73666021 ATACAGAAACAAAATTAGCCGGG + Intergenic
957075098 3:75596196-75596218 ATAAGGATACAGCTTGGGCCGGG + Intergenic
957254351 3:77817478-77817500 ATAGATGTACAGATTGAGACTGG + Intergenic
958603018 3:96323396-96323418 ATACACACACAAAGTGAGCCAGG + Intergenic
958923987 3:100137721-100137743 ATACAAAAACAGAATTAGCCGGG - Intronic
959645018 3:108689524-108689546 ATACAGAAACAAAATTAGCCGGG + Intronic
959936636 3:112036405-112036427 CTACAAATACAGAATTAGCCAGG + Intronic
961137576 3:124526276-124526298 ATAAAAATACATATGGAGCCAGG + Intronic
961830289 3:129619732-129619754 TTTCAGATAGAGACTGAGCCAGG - Intergenic
962615314 3:137120553-137120575 TTAAAGATACAGATTGGGCCGGG - Intergenic
963426157 3:145127785-145127807 ATACAGGTAGTAATTGAGCCAGG + Intergenic
965270448 3:166611031-166611053 ATACAGAGACAGAGAGAGACAGG + Intergenic
966994109 3:185263410-185263432 ATAAAAATACAAAATGAGCCGGG - Intronic
967002261 3:185347325-185347347 ATACAGATACAGATATATCAAGG + Intronic
968828306 4:2915660-2915682 ATACAAATACAAAATTAGCCAGG + Intronic
969018695 4:4123849-4123871 ATAAAGATACAGCATGGGCCGGG + Intergenic
970103374 4:12552092-12552114 ATACAGATATAGATAGATACAGG - Intergenic
970975122 4:22034708-22034730 ATACAGATACTGATAAAACCTGG - Intergenic
971844098 4:31896144-31896166 AAACATATACATATTGGGCCAGG - Intergenic
972031015 4:34458241-34458263 ATACAGACACAGACAGAGGCAGG + Intergenic
972147959 4:36052805-36052827 ATACAAAAACAAAATGAGCCGGG + Intronic
972521486 4:39861295-39861317 ATACAAAAAAAGATTTAGCCAGG + Intronic
977241255 4:94572715-94572737 ATACAGACACAGATGGGGCATGG + Intronic
980169841 4:129275766-129275788 ATATAGATAGAGATTTATCCTGG - Intergenic
980788758 4:137590439-137590461 ATCCCGGTAAAGATTGAGCCAGG + Intergenic
986032423 5:3906599-3906621 ATAAAGAGACAGATTGAGGAGGG + Intergenic
987432139 5:17847572-17847594 TTACAGATACTGATTCATCCAGG + Intergenic
987612721 5:20227776-20227798 ATACTGATAGAGACTGAGCATGG - Intronic
987634758 5:20525820-20525842 ACACACACACACATTGAGCCAGG + Intronic
988532279 5:32038232-32038254 ATAAAGATACAGCTGGAGGCCGG + Intronic
988819648 5:34868901-34868923 AAACACAGACAGAATGAGCCTGG - Exonic
989984123 5:50676263-50676285 TTACTGATTCATATTGAGCCGGG + Intronic
990586285 5:57214422-57214444 CTACAGATACAAAATTAGCCAGG + Intronic
990682490 5:58260884-58260906 ACACACATACAAATTTAGCCGGG + Intergenic
992127289 5:73654735-73654757 ATCCAGATACAGATTCATCATGG + Intronic
996053447 5:118958295-118958317 ATACAAAAACAAAATGAGCCGGG + Intronic
998092922 5:139381431-139381453 ATACAAATACAAAATTAGCCGGG + Intronic
1001904117 5:175456805-175456827 ATACAAAAACAAAATGAGCCGGG + Intergenic
1002340322 5:178512499-178512521 AGACAGATACAGAGTGTGCCAGG + Intronic
1003182213 6:3801674-3801696 ATACTGGGACAGATTAAGCCAGG + Intergenic
1004743081 6:18482081-18482103 ATAGAGGTACAGATGGAGGCAGG - Intergenic
1005970912 6:30761010-30761032 ATAAAAATACAGAATTAGCCGGG - Intergenic
1008639112 6:53443408-53443430 ATTAAGACACAGATTGAGGCTGG + Intergenic
1008738549 6:54577041-54577063 ATACAGAAACAAAATTAGCCGGG - Intergenic
1012202101 6:96419447-96419469 ATACAAATGGAGATTGTGCCTGG - Intergenic
1012275421 6:97268343-97268365 ATACAAAAACAGAATTAGCCAGG - Intronic
1013508102 6:110819194-110819216 CTACAAATACAAAATGAGCCGGG + Intronic
1014463431 6:121727799-121727821 CTAAATATACATATTGAGCCAGG + Intergenic
1015742902 6:136476974-136476996 ATACAAATACTAATTGATCCAGG + Intronic
1016247243 6:141997088-141997110 ATAAAGATACATATAGAGCAGGG + Intergenic
1017995440 6:159528010-159528032 AATCAGATGCAGATGGAGCCTGG + Intergenic
1020027948 7:4912399-4912421 ATACAAAAACAAAATGAGCCAGG + Intronic
1020552015 7:9619305-9619327 ATACACATACAGTTTCAGCAGGG + Intergenic
1022297144 7:29066863-29066885 ACAGAGAGGCAGATTGAGCCAGG + Intronic
1024998617 7:55295320-55295342 ATACATAGACATATTGAGCCAGG + Intergenic
1025616089 7:63118259-63118281 ATACAGATACAAAATTAGCCAGG + Intergenic
1026408004 7:70088282-70088304 ATACAAAAACAAATTTAGCCAGG - Intronic
1026610572 7:71855987-71856009 ATACATATACATATTGAGACAGG + Intronic
1026671572 7:72395389-72395411 TTCCAAATACAGTTTGAGCCTGG - Intronic
1026826174 7:73583194-73583216 ATACAGGTGGAGAGTGAGCCTGG + Intergenic
1029067786 7:97869520-97869542 ATACAGATACAAATGCAGGCTGG + Intronic
1030218468 7:107071906-107071928 ATACAAAAACAAAATGAGCCGGG + Intronic
1031281607 7:119809421-119809443 ATAAAGCTTCAGATTGAGCTAGG - Intergenic
1032392508 7:131565146-131565168 ATAAAGAAAGAGATTTAGCCTGG + Intergenic
1032537767 7:132678675-132678697 ATTCAGACAGACATTGAGCCAGG + Intronic
1033972388 7:147058139-147058161 TTACAGATTCAAATTGATCCTGG - Intronic
1034620986 7:152456988-152457010 ATAAAGTTACTGATTTAGCCGGG + Intergenic
1037523890 8:19706303-19706325 ATACAGATACAGATTGAGCCTGG - Intronic
1038897116 8:31796591-31796613 ATACAGAAACAAAATTAGCCTGG - Intronic
1039842189 8:41302088-41302110 CTATAGATACAGATTGAGGGTGG - Intronic
1040023159 8:42758518-42758540 ATAAAGATACAAAATTAGCCCGG - Intronic
1040355575 8:46614876-46614898 ATACAGATACAAATGCAGGCTGG + Intergenic
1040410517 8:47149692-47149714 ATACAGAAAAAGAATTAGCCGGG + Intergenic
1041392993 8:57363829-57363851 AGACAGAGCCAGATTGAGCCAGG - Intergenic
1043697516 8:83239074-83239096 ATAAAGATACAAAATGAGCCAGG - Intergenic
1044179339 8:89168971-89168993 GAACAGATTCTGATTGAGCCAGG - Intergenic
1044470830 8:92564918-92564940 ATACAAATATAGATAGAGTCAGG - Intergenic
1045666596 8:104493897-104493919 ATACAGACACAGATTAACCAAGG - Intronic
1045907958 8:107371086-107371108 AAACAGTTACAGCTTGAACCTGG + Intronic
1046408650 8:113809967-113809989 ATACAGATAAGCATGGAGCCAGG - Intergenic
1047132163 8:122033640-122033662 AGTCACATACAGATGGAGCCAGG + Intergenic
1047248716 8:123166057-123166079 ATAAAGATACAGAGGGAGTCGGG + Intergenic
1047707668 8:127516789-127516811 ATACAACTGCAGATTGAGCATGG - Intergenic
1049992244 9:1000908-1000930 ATACCTATACAAATTCAGCCTGG - Intergenic
1050481159 9:6088037-6088059 AAACAGATACAGATTGAGTCAGG - Intergenic
1050975975 9:11938423-11938445 ATAGAGATACAGATAGATACAGG + Intergenic
1052925017 9:34008150-34008172 ATACAAATACAAAATTAGCCGGG + Intronic
1053534115 9:38908781-38908803 AGACAGACACAGAGGGAGCCGGG + Intergenic
1054206339 9:62133200-62133222 AGACAGACACAGAGGGAGCCGGG + Intergenic
1054632019 9:67455146-67455168 AGACAGACACAGAGGGAGCCAGG - Intergenic
1055501713 9:76907914-76907936 AAACAGACACACATTGAGACAGG - Intergenic
1055517531 9:77048333-77048355 CTACAAATACAGAATTAGCCAGG - Intergenic
1056973806 9:91232227-91232249 ATAGAGATACAAAATCAGCCAGG + Intronic
1058041297 9:100304695-100304717 CTACAGATACAAAATTAGCCAGG + Intronic
1059091708 9:111366387-111366409 ATACAGATAGAAATTGTGACAGG - Intronic
1060090653 9:120739901-120739923 AAACAGATACAGTTTCAGCCAGG + Intergenic
1062508628 9:136892011-136892033 AGACAGATTCAGAATGGGCCGGG - Intronic
1190728515 X:53208664-53208686 ATAAAAATACAGAATTAGCCGGG - Intronic
1195430731 X:104786316-104786338 GAACAGATACAGATTGAGGAAGG - Intronic
1195821681 X:108951932-108951954 ATACAAAAACAGCTTGAGCAAGG - Intergenic
1196455637 X:115889540-115889562 ATACAGCTAGATATTGAGCCAGG + Intergenic
1196463514 X:115951672-115951694 ATCCAGCTAGAGAGTGAGCCAGG - Intergenic
1197940208 X:131781303-131781325 ATAAAAATACAAATTTAGCCGGG - Intergenic
1199349686 X:146786480-146786502 ATAAAGATACTAATTGAGACTGG - Intergenic
1201318491 Y:12671636-12671658 ATTAAGATAAAGATTGGGCCGGG - Intergenic
1202580373 Y:26374504-26374526 TTAGAGATAAAAATTGAGCCTGG + Intergenic