ID: 1037529041

View in Genome Browser
Species Human (GRCh38)
Location 8:19756733-19756755
Sequence GCTGGGATGGAGAGGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1303
Summary {0: 1, 1: 0, 2: 12, 3: 121, 4: 1169}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037529041_1037529052 17 Left 1037529041 8:19756733-19756755 CCCTCCACCCTCTCCATCCCAGC 0: 1
1: 0
2: 12
3: 121
4: 1169
Right 1037529052 8:19756773-19756795 CGCAGTCATCGCGCGGCACGTGG No data
1037529041_1037529053 22 Left 1037529041 8:19756733-19756755 CCCTCCACCCTCTCCATCCCAGC 0: 1
1: 0
2: 12
3: 121
4: 1169
Right 1037529053 8:19756778-19756800 TCATCGCGCGGCACGTGGAAAGG No data
1037529041_1037529050 10 Left 1037529041 8:19756733-19756755 CCCTCCACCCTCTCCATCCCAGC 0: 1
1: 0
2: 12
3: 121
4: 1169
Right 1037529050 8:19756766-19756788 CAATAACCGCAGTCATCGCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037529041 Original CRISPR GCTGGGATGGAGAGGGTGGA GGG (reversed) Intronic
900074934 1:806484-806506 ATTGGGATGGAGAGGGCTGAAGG + Intergenic
900269759 1:1781055-1781077 GCAGGGATGGGGAGGGTGGAGGG + Intergenic
900278386 1:1848465-1848487 TCTTGGATGGAGGTGGTGGAAGG - Intronic
900320837 1:2082844-2082866 GGCGTGAGGGAGAGGGTGGAGGG + Intronic
900431690 1:2605812-2605834 GCTGGACTGGAGAGGGTGGCGGG + Intronic
900605397 1:3521484-3521506 CCTGGGATGGGGAGGGTGTTGGG - Intronic
900650093 1:3726298-3726320 GGATGGATGGAGTGGGTGGATGG + Intronic
900650202 1:3726694-3726716 GGTTGGATGGGGTGGGTGGATGG + Intronic
900672823 1:3866329-3866351 CCTGGGAGGCAGAGGGTGCAGGG - Intronic
900802711 1:4747324-4747346 GGTGAGGTGGAGAGGGGGGATGG - Intronic
900848181 1:5120622-5120644 GGTGGGTAGGAGTGGGTGGATGG - Intergenic
901613483 1:10518248-10518270 GATGGGATGGGGAGGGTTAAGGG + Intronic
901734209 1:11302021-11302043 TCTGGGATGGAATGGGTGCAGGG + Intergenic
901779625 1:11585098-11585120 GATGGGGTGGAGAGGGAGCATGG + Intergenic
902379910 1:16048068-16048090 GCTGGGGTGGGTAGGGTGGTTGG - Intronic
902538974 1:17138925-17138947 GAGTGGATGGAGAGGGTGGAAGG + Intergenic
902613790 1:17612778-17612800 GCTGGGGCGGAGAGGCGGGAGGG - Intronic
902652261 1:17844559-17844581 GCTGGGAGGAGGAGGGAGGAGGG + Intergenic
902770435 1:18642724-18642746 GCTGGGGTGGAGCAGGGGGAGGG + Intronic
902791677 1:18773060-18773082 GCAGGGATGGGGATGGTGGGTGG + Intergenic
902835387 1:19043768-19043790 ACTGGGTGGGAGGGGGTGGAGGG + Intergenic
902993675 1:20207227-20207249 GGTGGGATGTGGAGGGAGGAGGG - Intergenic
903057155 1:20644227-20644249 CATGGGATGGATAGGATGGATGG + Intronic
903243355 1:21998807-21998829 TCTGGGAAGGAGAGGGAGGGCGG - Intergenic
903530479 1:24026476-24026498 GCTGTGGTGGGGATGGTGGACGG + Intergenic
903875736 1:26472171-26472193 GCTGGGTTGCATAAGGTGGAAGG + Intergenic
904031246 1:27534783-27534805 GATGGGTGGGAGGGGGTGGAGGG + Exonic
904377591 1:30091501-30091523 GAAGGGATGCAGAGGATGGAGGG + Intergenic
904449969 1:30604903-30604925 GCTAGGGTGGAGAGCGGGGAGGG - Intergenic
904478958 1:30782424-30782446 GCTGGGCTGGTGGGGGTGGTCGG - Intergenic
904521755 1:31101271-31101293 GGTGGGGTAGAGAGGGAGGAAGG + Intergenic
904536043 1:31200152-31200174 GCTGGGATAGAGAGGCAGCAAGG - Intronic
904810873 1:33162681-33162703 GATGGGAGGGAAAGGGGGGAAGG + Intronic
904811968 1:33169265-33169287 GCTGGGATGGAGTTAGGGGAGGG - Intronic
905037483 1:34927607-34927629 GCTGGGAGGGCTAGGGTGGCAGG - Intronic
905194047 1:36260343-36260365 GCTGGGAAGGGGAGTGGGGAAGG - Intronic
905222289 1:36456707-36456729 GCTGGGGTAGAGAGGAAGGAAGG + Intronic
905343215 1:37293365-37293387 ACTGGGGAGGAGAGGGTGGTGGG - Intergenic
905790107 1:40785011-40785033 ACTGGGAAGTTGAGGGTGGAGGG - Intronic
905828979 1:41049027-41049049 TGTGGGAGGTAGAGGGTGGAGGG + Intronic
905875218 1:41427881-41427903 GCGGGGAGAGAGAGGGAGGAGGG - Intergenic
905910963 1:41654036-41654058 GCTGGGAAGGAGTAGGTGCAAGG - Intronic
906043193 1:42805427-42805449 GCTGGGATGTCCAAGGTGGAGGG - Intergenic
906098358 1:43239436-43239458 ACAGGGCTGTAGAGGGTGGAGGG + Intronic
906139715 1:43526746-43526768 GCTGGGATGGAGGGAGTAGAGGG + Intronic
906142935 1:43544505-43544527 GCAGGGAGGGAGAAGGTGGGAGG - Intronic
906156506 1:43617174-43617196 GCTGGGATGGGGCAGGTGAAGGG - Intronic
906197381 1:43937280-43937302 GTTGGGAAGAAGAGGCTGGATGG + Intergenic
906244244 1:44262061-44262083 GCTGGGCTGCGGTGGGTGGAGGG - Intronic
906588512 1:47001772-47001794 GCTGTGATGAAGAGCGTGGGAGG - Intergenic
906764803 1:48418856-48418878 GAGGGGAAGGAGAGGGAGGAAGG + Intronic
907213394 1:52842542-52842564 GCTGGGAAGGAGTGGGTGAGCGG + Intronic
907302758 1:53498796-53498818 GCTAGGAAGGAAAGGGTGGGAGG - Intergenic
907741439 1:57170070-57170092 CCTGGGATGCAGAGGTTGCAGGG - Intronic
908048900 1:60206013-60206035 GGAGGGATGGAGTGGGTGGAGGG + Intergenic
908623282 1:66009573-66009595 GCTGGGATGGTGTGAGGGGAAGG - Intronic
909460971 1:75913932-75913954 GCTGGGAAGTAGAGGTTGCAGGG - Intergenic
909756062 1:79227467-79227489 CCTGGGTTGGAGAGGGGGCAGGG - Intergenic
910725381 1:90332694-90332716 GCTGTGAAGGATAGTGTGGAGGG + Intergenic
910743389 1:90546610-90546632 GCAGGGATGGAAAAGTTGGAGGG + Intergenic
911110418 1:94178233-94178255 TATGGAATAGAGAGGGTGGAGGG + Intronic
911887160 1:103317763-103317785 ATGGGGATGGTGAGGGTGGAAGG + Intergenic
912428791 1:109617544-109617566 GCTGGTATGGAGTGGGTGGAGGG + Exonic
912474210 1:109925353-109925375 CCTGGAAAGGAGAGGGTGGCTGG - Intronic
912620623 1:111153123-111153145 GCTGGGATGGGTAAGGAGGAGGG - Intronic
912698572 1:111859380-111859402 GCGGGAAAGGAGAGGTTGGATGG + Intronic
914407025 1:147385691-147385713 GCAGTGATGGGGAAGGTGGAGGG - Intergenic
914784742 1:150818056-150818078 GAGGGGGTGGAGAGGGAGGAAGG + Intronic
914964062 1:152237477-152237499 GCTGGGATGGAGGGAGGGGAGGG + Intergenic
915243729 1:154541856-154541878 GTGAGGATGGAGAGAGTGGACGG + Intronic
915321503 1:155058792-155058814 GCTGGGATGGGGGAAGTGGAAGG + Intronic
915345593 1:155195310-155195332 GCCGGGATGGAGAGCCAGGAGGG - Intergenic
915406095 1:155660632-155660654 GCTGGGCTGGAGAGAGGGGCTGG + Exonic
915419256 1:155766428-155766450 GCTGGGCTGGAGAGAGGGGCTGG + Exonic
915444461 1:155966895-155966917 GGTGGGGTAGAGAGGGTGAAGGG + Intronic
915943431 1:160133480-160133502 GTTGGGATGGGGAGGGTGGCTGG - Intronic
915953436 1:160205269-160205291 GGAGGGATGGAGAGGCAGGAGGG - Intergenic
915954037 1:160208322-160208344 GCTTGGAAGGAGAGGGAGGCAGG + Intronic
916382793 1:164231620-164231642 GCTGGTAAGGGGAGGGTGGTGGG + Intergenic
916559843 1:165925197-165925219 ACTGAGACTGAGAGGGTGGATGG - Intergenic
916714922 1:167440460-167440482 GCTGAGATGGACAGGGTAGGAGG - Intronic
917865517 1:179190605-179190627 GGTGGGATGGAGGGGGGTGAGGG + Intronic
917965503 1:180176083-180176105 CCTGGGAGTGAGAGGGTGGTGGG + Intronic
918011782 1:180593524-180593546 GGTGGGAAGGACAGGGTGTACGG + Intergenic
918044868 1:180935608-180935630 TGTGGGATGGAGAGGGTGCTGGG + Exonic
919487027 1:198157732-198157754 GCTGGGAGAGAGTGGGTGGTGGG + Intronic
919716843 1:200787083-200787105 GCTGTGATGGAGAGGGACAAGGG + Intronic
919759272 1:201087083-201087105 GCTGTGCTGGGGTGGGTGGAGGG + Intronic
919762472 1:201106697-201106719 TGTGGGATGGTGAGGGTGGAGGG - Intronic
919943454 1:202304043-202304065 GCTGGGCTGGAGAGGGCTGTGGG - Intronic
920036362 1:203068244-203068266 GCAGGGATGGAGTGAGTGGGGGG + Intronic
920263152 1:204703292-204703314 GCTGGGAGGGCCAAGGTGGAGGG + Intergenic
920980334 1:210828495-210828517 GATGGGGTGGAATGGGTGGATGG - Intronic
921187748 1:212684709-212684731 GCTGGGGAGGAGAGGGTCCATGG - Intergenic
921193864 1:212733483-212733505 GGAAAGATGGAGAGGGTGGAAGG - Intronic
921262897 1:213399646-213399668 GCGGGGGAGGAGAGGGTGGGCGG - Intergenic
921559403 1:216639290-216639312 AATGGGGTGGAGAGGGTGAAGGG + Intronic
922214144 1:223507041-223507063 GCTGGGAAGAAGATGGAGGATGG + Intergenic
922270778 1:224031389-224031411 ATTGGGATGGAGAGGGCTGAAGG + Intergenic
922425028 1:225484579-225484601 GCTGGGAGGGAGTGGCTGGAAGG + Intergenic
922707049 1:227795408-227795430 CGTGGGAAGGAGAGGGTGGGGGG - Intergenic
922775659 1:228213255-228213277 GCTGGAAAGGAGAGGGTGCAGGG - Intronic
922891125 1:229062553-229062575 GCTGGGAGGGAGGGAGTGGCTGG + Intergenic
922934278 1:229411486-229411508 GCTGGAAAGGGGAGGGGGGAGGG - Intergenic
923226019 1:231939660-231939682 GCTTGGAAGAAGAGGGAGGATGG - Intronic
923384471 1:233452996-233453018 GGGGAGATGGAGAGGGGGGAGGG - Intergenic
924250083 1:242123854-242123876 ACTGGGAAGGTGAGGGTGGGTGG + Intronic
924337608 1:242999266-242999288 CGTGGGATGGAGAGAGAGGAGGG - Intergenic
924370770 1:243347989-243348011 CCTGGGTTGGTGAGGGAGGAGGG - Intronic
924599363 1:245474783-245474805 GCTGGGATGGGCAGCGGGGATGG - Intronic
924776105 1:247115229-247115251 GCTGGGATGGACACGGTGGGGGG + Intergenic
1062932236 10:1360971-1360993 GGGGGGCTGGGGAGGGTGGAGGG + Intronic
1063018247 10:2100175-2100197 GCTGGGATGGGAACGGTGGATGG - Intergenic
1063503822 10:6579287-6579309 ACTAGGCTGGAGAAGGTGGAGGG - Intronic
1063781679 10:9332143-9332165 GCTGGGATGGAGGGGGTGCCTGG - Intergenic
1063899054 10:10713013-10713035 GTTGGGATGGACAGGAAGGATGG - Intergenic
1064086277 10:12349011-12349033 GCTGGGATGGAGGCGGAGGCGGG - Intergenic
1064243938 10:13654704-13654726 GGTGGGATGCAGAGGTTGGGGGG - Intronic
1064265368 10:13821246-13821268 GCTGTGCTGGAGAGGCAGGAAGG - Intronic
1064443359 10:15372049-15372071 GCTGGGCAGGACAGGGCGGATGG + Intergenic
1064960472 10:20958318-20958340 GGGGGCAAGGAGAGGGTGGATGG + Intronic
1065111528 10:22444705-22444727 GCTGGAACGGAGAGGGAAGAAGG + Intronic
1065232782 10:23615603-23615625 GCTTGAGTGGGGAGGGTGGAAGG - Intergenic
1065481202 10:26195598-26195620 GCTGGAGTGGAGAGTTTGGAGGG - Intronic
1065828462 10:29593571-29593593 GCCGGGAGGCAGAGAGTGGAAGG - Intronic
1066651922 10:37664504-37664526 GCTGGCTTGGAGATGGAGGAAGG - Intergenic
1066658943 10:37721010-37721032 GGTGGGAAGCAGAGGCTGGATGG - Intergenic
1067035697 10:42914815-42914837 GCTGGCTTGGAGATGGAGGAAGG - Intergenic
1067261271 10:44694327-44694349 GCTGGGAAGGAGAGGGAGACAGG - Intergenic
1067337898 10:45379279-45379301 GAGGGGCTGGAGAGGGAGGAAGG - Intronic
1067358090 10:45549787-45549809 CCTGGGATGGAGAGAAGGGAAGG - Intronic
1067375864 10:45727312-45727334 GCTGGGATGGTGAGGGCGGCGGG + Exonic
1067601840 10:47612133-47612155 GCTGGATTGGAGTGGGTGGGTGG + Intergenic
1067691658 10:48505730-48505752 GCTGGGATGGAGAGAGGGGTAGG + Intronic
1067808906 10:49411949-49411971 GCTGGGAAGGAGGTGGGGGAAGG + Intergenic
1067972998 10:50992523-50992545 GTTGGGATGAAGAAGGCGGAGGG + Intronic
1068003963 10:51370980-51371002 GCTGGAATATAGAGGGTGTAGGG - Intronic
1068533136 10:58210967-58210989 GATGGGAGGAAGATGGTGGATGG - Intronic
1068830674 10:61491272-61491294 GCAGGGAGGGAGAGGGAGGCAGG + Intergenic
1069023388 10:63514629-63514651 GGAGGGAGGGAGGGGGTGGAAGG + Intergenic
1069638212 10:69938311-69938333 GCTGGGCTGGATAGGGCTGATGG + Intronic
1069736266 10:70656726-70656748 GCTGGGATGCAGAGAGCGGAAGG + Intergenic
1069905243 10:71728417-71728439 TCTGGGGTGGGGAGGGTGGCAGG - Intronic
1070240381 10:74674292-74674314 GCTGGTGTGGAGAGGGAGCAGGG - Intronic
1070334054 10:75439034-75439056 GCTGGTGTGGAGTGGGTGGGAGG + Intronic
1070814168 10:79312771-79312793 GGTAGGATGCAGAGTGTGGAGGG - Exonic
1071268262 10:83983614-83983636 GCTGGAATGGAGAAGGAGGAGGG - Intergenic
1071573027 10:86708331-86708353 GCTGGGGTGGAGCGGGAGGTGGG + Intronic
1071718835 10:88122707-88122729 GCAGGGATGGAGATGGAGGAGGG + Intergenic
1071901833 10:90128856-90128878 GCTGGGATGGTGGTGGTGGGAGG - Intergenic
1072546361 10:96442442-96442464 GTTGGGATGGGAAGGATGGAGGG + Intronic
1072622190 10:97087405-97087427 GCAGGGATGGAGACGGGGGAGGG - Intronic
1072784906 10:98272874-98272896 GCTGGCAGGGAGAGGGTTGAAGG + Intergenic
1073109388 10:101052013-101052035 GCTAGGATAGAGAGGTGGGAGGG - Intergenic
1073267141 10:102234568-102234590 GCTGGGAAGATGAGGGAGGAAGG + Intronic
1073499374 10:103922067-103922089 GCTGTGATGGAGTGGGAGCACGG + Intergenic
1073630289 10:105141397-105141419 GTGGGGACAGAGAGGGTGGAGGG + Intronic
1073688618 10:105783377-105783399 TCTGGGCTGGAGGGGGTGGGGGG - Intergenic
1073756101 10:106582341-106582363 GCAGAGATGGGGAGGGTGAATGG - Intronic
1073779888 10:106825612-106825634 GCTGGGATGCAGAAGGTGATGGG - Intronic
1073989886 10:109250823-109250845 ACTGGAGTGCAGAGGGTGGAAGG - Intergenic
1074101907 10:110360315-110360337 GTTGGAATGGAGAGGCTGGGAGG - Intergenic
1074135070 10:110618903-110618925 AGTGGGATGGAGAGGGCAGATGG + Intergenic
1074400555 10:113138238-113138260 GGTGGGGTGGAGGGGGTGGCAGG - Intronic
1074445995 10:113521328-113521350 GCCTGGATGGAGAGGCTGGTCGG + Intergenic
1074873164 10:117593786-117593808 GCTGGTATATAGAAGGTGGATGG + Intergenic
1074921673 10:118020585-118020607 GCTGGGATGGGGCTGGGGGAAGG - Intronic
1075144121 10:119868895-119868917 GCTGGGATGGAGTATGAGGAGGG + Intronic
1075275443 10:121088971-121088993 ATTGAGATGCAGAGGGTGGATGG + Intergenic
1075469428 10:122676971-122676993 GCTGTCATGGATAGGGTGGAAGG - Intergenic
1075665137 10:124224444-124224466 GCTGGGGTGGAGTGGGTCCAGGG + Intergenic
1075925851 10:126251557-126251579 GGTGGGATGGATGGGATGGATGG + Intronic
1075925870 10:126251646-126251668 GATGGGATGGATAGGAAGGATGG + Intronic
1075925877 10:126251672-126251694 GATGGGATGGAGAGGATGGATGG + Intronic
1075925908 10:126251815-126251837 GATGGGATGGATAGGATAGATGG + Intronic
1075925927 10:126251893-126251915 GATGGGATGGATAGGATGGATGG + Intronic
1075925933 10:126251915-126251937 GATGGGATGGATAGGATGGATGG + Intronic
1075925957 10:126252026-126252048 GGTGGGATGGATAGATTGGATGG + Intronic
1075925970 10:126252090-126252112 GATGGGATGGATTGGATGGATGG + Intronic
1075942997 10:126407300-126407322 GCCAGGCTTGAGAGGGTGGAGGG + Intergenic
1076101069 10:127778952-127778974 GCTGGGAGGCAGAGGTTGAAGGG - Intergenic
1076131123 10:128014708-128014730 GCTGGGGTTGAGACGGGGGATGG - Intronic
1076227664 10:128793167-128793189 GATGGGGTGGAGAGGAAGGAAGG + Intergenic
1076280464 10:129242259-129242281 GCTGGGGTGGAGAGGGAGAATGG + Intergenic
1076302661 10:129439928-129439950 CCTGGGATGGTGTGGGTGGTGGG - Intergenic
1076338698 10:129728113-129728135 GCTGGGTGAGAGAGGGAGGAGGG + Intronic
1076658724 10:132041335-132041357 GGTGGGCTGGAGTGGGTGGTAGG + Intergenic
1076698310 10:132257536-132257558 GCTGCGAAGGAGTGGGTGGCAGG + Intronic
1076883879 10:133252485-133252507 GCAGGGAGGGATAGGGTGCAGGG - Intergenic
1076903386 10:133350730-133350752 CCTGGGATGGATCGGGAGGAAGG + Intronic
1077020242 11:414066-414088 GTGGGGAGGGAGAGGGTGCAGGG - Intronic
1077035593 11:492990-493012 GCGGGGATGGACAGCGTGGGTGG - Intergenic
1077094049 11:791891-791913 GCTGGGGTGGAGCGGGTGCTGGG + Exonic
1077283114 11:1754358-1754380 GGAGGGATGGAGGGGATGGAGGG + Intronic
1077283166 11:1754514-1754536 GGAGGGATGGAGGGGATGGAGGG + Intronic
1077283176 11:1754539-1754561 GGAGGGATGGAGGGGATGGAGGG + Intronic
1077283193 11:1754601-1754623 GAGGGGATGGAGGGGATGGAGGG + Intronic
1077402534 11:2366306-2366328 GCTCGGGTGGAGTGGGTGGGTGG - Intergenic
1078004443 11:7522073-7522095 GCTGGGAAGGGCAGGTTGGAGGG + Intronic
1078286413 11:9959773-9959795 GCTGAGATGGTCATGGTGGAAGG + Intronic
1079335298 11:19565387-19565409 TCTTGGATGAAGAGGGAGGAGGG - Intronic
1079651226 11:22932691-22932713 GCAGGGAAAGAGAGGGAGGAAGG - Intergenic
1080309618 11:30874502-30874524 GCAGGGAGGAAGAGGGAGGAGGG + Intronic
1080322748 11:31033024-31033046 GCTGGGATGGAATTGCTGGAAGG - Intronic
1080357442 11:31466752-31466774 GCTGGGAAGGGGAGGTAGGAGGG + Intronic
1080569555 11:33543442-33543464 GCTTGTATGGAGAGTATGGAAGG - Exonic
1080577004 11:33609265-33609287 GCTGGGACGGACAGGGTGGAAGG - Intronic
1080644720 11:34180195-34180217 GCTGGGATGGAGTGGGTGGTGGG - Intronic
1081231984 11:40596602-40596624 GCTGGGAAGGGGAGTGGGGAGGG - Intronic
1081547690 11:44083408-44083430 GCAGGTACTGAGAGGGTGGAAGG - Exonic
1081641102 11:44755139-44755161 GGTGGGATGAGGAGGGTGGAAGG - Intronic
1081701552 11:45155640-45155662 GGAGGGGTGGAGAGGGAGGAAGG + Intronic
1082665956 11:55976577-55976599 GCTGGGATGGGATGGGAGGAAGG - Intergenic
1082911563 11:58381736-58381758 GCTGGGAAGGCTAGGGAGGAAGG + Intergenic
1083024027 11:59534735-59534757 GCTGCGATGGAGGGGTTGGAGGG + Intergenic
1083172948 11:60933788-60933810 ACTGGGACGGAGAGGGCGCAGGG + Intronic
1083254312 11:61486873-61486895 GCAGGGATGGAGAGGGGAGCAGG - Intronic
1083484772 11:62976495-62976517 CCGGGGATGGAGTGGGTGGGAGG + Intronic
1083632257 11:64101883-64101905 GATGGGGTGGACAGGGTGGCAGG - Intronic
1083729144 11:64643538-64643560 GCTGGAAGGGAGAGGGAGGGAGG + Intronic
1083891054 11:65595881-65595903 GCTGGGATGGCTGGGGTGGCTGG + Exonic
1083891079 11:65595980-65596002 GCTGGGATGGTGGGGATGGGTGG + Exonic
1083998666 11:66284387-66284409 GCTGGGAAAGAGAAGATGGAAGG - Intronic
1084149689 11:67282373-67282395 GTGGGGAGGGAGAGGGTGGGGGG - Intronic
1084182551 11:67454148-67454170 GGTGGGATGGTGAGGGTGAGGGG + Intronic
1084400206 11:68939007-68939029 GCTGGGAAGGACAGGGCCGATGG + Intronic
1084559120 11:69892871-69892893 GCTGGGAAGGAGAGAGGGGCTGG - Intergenic
1084953191 11:72677989-72678011 GTGGGGATGGAGGGAGTGGATGG - Intergenic
1085820377 11:79786689-79786711 GATGGGCGGCAGAGGGTGGAGGG + Intergenic
1086164751 11:83764498-83764520 GCTGTGGTGGTGAGGTTGGATGG + Intronic
1087174248 11:95081640-95081662 GCTGGAATGAAGACGGGGGAAGG - Intergenic
1087243963 11:95812512-95812534 GGTGGGGTGGGGAGTGTGGAGGG - Intronic
1087689188 11:101299457-101299479 TCTGGGAAGGAGAGGGAGGTGGG - Intergenic
1087905838 11:103696166-103696188 GCTGGGGAGGGGAGGGAGGAGGG - Intergenic
1088312398 11:108473921-108473943 GGTGGCATGGAGACTGTGGAGGG - Exonic
1088645662 11:111914129-111914151 GCTGGGATGGGGAGGGAGGGAGG + Intronic
1088648203 11:111934623-111934645 GGTGGGATCGGGAGGATGGAAGG + Intronic
1088665125 11:112086615-112086637 GCGGGGACGGGGAGGGTGAAGGG - Intronic
1089127758 11:116189409-116189431 GCTGGAAAGGAGAGGCTGGATGG - Intergenic
1089493671 11:118898298-118898320 GGTGGGGTGGAGGGGGTGGGAGG - Exonic
1089504346 11:118953610-118953632 GCTGGGGTGGGGAAGGTGGGGGG + Intronic
1089573485 11:119424856-119424878 GCTGGGATGGAGTTGGAGGGAGG - Intronic
1089696329 11:120218455-120218477 GCTGGGCTGGGGAGGGGAGAGGG - Intronic
1089701448 11:120246535-120246557 TCGGGGATGGAGGGGGTGGGGGG + Intronic
1089776272 11:120838860-120838882 CCTGGGAGGCAGAGGTTGGAAGG - Intronic
1089789550 11:120932816-120932838 GCTGGCATGTAGAGGGGGCAGGG + Intronic
1090130943 11:124141623-124141645 GCTGAGATGCAGAAGGAGGACGG - Exonic
1090419468 11:126564281-126564303 CCTGGGCTGCAGACGGTGGATGG - Intronic
1090560758 11:127929670-127929692 GCAGGAAAGGAGAGGGTGTAGGG + Intergenic
1090766163 11:129878105-129878127 GCTGTGGTGGAGAGAGGGGACGG - Intronic
1091173778 11:133541849-133541871 GGTGTGATGGAGTGGCTGGAGGG - Intergenic
1091962870 12:4713428-4713450 GCTGGGTGGGAGGAGGTGGAGGG - Intronic
1092173650 12:6388725-6388747 GCTGGGATGTGGAGGCTGAAAGG + Intronic
1092254230 12:6917458-6917480 GCAGGGGTGGGGAGGGAGGAGGG + Intronic
1092284336 12:7120210-7120232 GCTGGAAAGGTGAGTGTGGAAGG + Intergenic
1092479106 12:8844223-8844245 GTTGGGAGGGAGAGTGGGGAGGG + Intronic
1092825600 12:12395821-12395843 GCTGGGGTGGGGATAGTGGAAGG + Intronic
1093541990 12:20298578-20298600 GCTGCGCTGGAGAGGCTGGGTGG + Intergenic
1093639625 12:21511331-21511353 GGTGGGTTGGGGAGGGTGGGGGG - Intronic
1093975564 12:25417256-25417278 GCTGGGAAGGATAGTGGGGAGGG - Intronic
1094033368 12:26039371-26039393 GCTGGGTGTTAGAGGGTGGAGGG + Intronic
1094181153 12:27593869-27593891 GATGGGAGGGAGAAAGTGGATGG + Intronic
1094581660 12:31739195-31739217 GCTGGGGTGGAGATGGGGGTTGG + Intergenic
1094809442 12:34123556-34123578 ACTGGGGTGGGGAGGGGGGAGGG - Intergenic
1095195930 12:39317501-39317523 GCAGGGGTGGAGAAGTTGGAGGG - Intronic
1095424433 12:42060446-42060468 GGTGGGATGAAGGGGGAGGAAGG - Intergenic
1095947814 12:47763747-47763769 GATGGGAGGGAGAGGAGGGATGG + Intronic
1096078635 12:48819503-48819525 GCAGAGATGGAGGGGGTGGAAGG - Intronic
1096501516 12:52066792-52066814 GCTGAGTTGGAGTGTGTGGATGG + Intergenic
1096521280 12:52186134-52186156 GCTCGGCTGGACAGGGTGGAGGG - Intronic
1096521419 12:52186834-52186856 GCTGGGCTGGACTGGGTAGAAGG - Intronic
1096618231 12:52846675-52846697 GCTGGGAGGGAAAAGGTGGGAGG - Intronic
1097108003 12:56636377-56636399 ACTGGGGTGGGGAGGGAGGAGGG + Exonic
1097189885 12:57214609-57214631 GCTGGCTGGCAGAGGGTGGAGGG - Intergenic
1097350846 12:58547058-58547080 GCTGGGATAGAGAGGGTGACTGG + Intronic
1097430636 12:59501122-59501144 GCTGGCGTGGATAGGGTGAAGGG - Intergenic
1098302520 12:69068823-69068845 CCTGGGAGAGAGATGGTGGAGGG + Intergenic
1098613290 12:72488297-72488319 GCTGAGAGTGAAAGGGTGGAAGG + Intronic
1098876039 12:75867406-75867428 GCTGGGAGGAAGAGTGAGGAGGG - Intergenic
1099248045 12:80217299-80217321 GATGGGAAGGGGAGGGAGGATGG + Intronic
1099304597 12:80937764-80937786 GCGGGGGTGGAGAGGGAAGACGG + Exonic
1099411058 12:82328697-82328719 GTAGGAATGGAGAGGGTGGGGGG + Intronic
1100874291 12:98945976-98945998 AAGGGGATGGAGAAGGTGGATGG - Intronic
1100956843 12:99918062-99918084 GCTGGGATGGGGAGAGTGGTTGG - Intronic
1101348157 12:103905251-103905273 GGGGGGAGGGAGAGGGAGGAAGG + Intergenic
1101404885 12:104419460-104419482 GCTGGGGTGGGGAGGTTAGAAGG - Intergenic
1101466731 12:104957744-104957766 GCTGGGATGGAGATGCTGCGAGG - Intronic
1102027701 12:109722986-109723008 GCTTGGAGGGAGCGGGTGGGGGG + Intronic
1102462782 12:113110202-113110224 GCTGGGGAGGAGGGGGAGGAGGG + Intronic
1102543898 12:113641205-113641227 GCTGGGGTGGAGGTGGAGGAAGG - Intergenic
1102706935 12:114889775-114889797 ACTGGAATGGGGAGGGGGGATGG - Intergenic
1102960704 12:117091665-117091687 GCTGGGAGGAAGAGGCAGGAGGG - Intronic
1103367038 12:120390876-120390898 GCCAGGCTGGAGAGGGAGGAAGG - Intergenic
1103527603 12:121578629-121578651 GGTGGGGTGGTGAGGGAGGAGGG - Intronic
1103597928 12:122035442-122035464 GCTGGGCAGGAGAGGCTGGCAGG - Intronic
1104568757 12:129907204-129907226 GCTGGGAAGGAGAGAGTGACAGG - Intergenic
1104602087 12:130161415-130161437 GGTGGGATGGAGTGGGTCGTGGG - Intergenic
1104610062 12:130220344-130220366 GCTGGGCTGGAGAGGAGGGAAGG + Intergenic
1104664200 12:130635829-130635851 GCTGGAATGTAGAGTGGGGAAGG - Intronic
1104727877 12:131088731-131088753 GCTGGTGTGGCGGGGGTGGAGGG + Intronic
1104789249 12:131471620-131471642 CCTGGGATGGAGGACGTGGATGG + Intergenic
1105018995 12:132804040-132804062 GCGGGGACTGAGGGGGTGGAAGG + Intronic
1105204734 13:18211459-18211481 GCTAGGAGGGGGAGGGAGGAAGG + Intergenic
1105264329 13:18802847-18802869 GTTGGGGTGGAGTGGGTGGTGGG - Intergenic
1105287961 13:19022778-19022800 GCAGGGAGGGGGAGGGAGGAAGG + Intergenic
1105313626 13:19236276-19236298 GCAGGCATTGAGAGTGTGGATGG - Intergenic
1105446554 13:20462125-20462147 GGAGGGATGGAGTGGGAGGAGGG + Intronic
1105578852 13:21675397-21675419 GCTGGGAAGGCGAGGGTAGGAGG - Intronic
1105606118 13:21927778-21927800 GGTGGAGTGGGGAGGGTGGACGG - Intergenic
1106144752 13:27040827-27040849 GCTGGAATGGAAAGGCAGGAGGG - Intergenic
1106295918 13:28413382-28413404 GCTGGGAGGGAGAGAGTGTCTGG - Intronic
1107528996 13:41263787-41263809 GCGGGGATGGAGATGGTGGGAGG + Intergenic
1107549965 13:41464945-41464967 CCTGGGCAGGAGAGGGTGGGGGG + Intronic
1107953702 13:45488217-45488239 GCTGGGGTGGGTTGGGTGGAGGG + Intronic
1108346432 13:49551153-49551175 GCAGGGAGGGAGAAGGAGGAAGG + Intronic
1109092123 13:58061397-58061419 GCTGGGATGCAGTGGTTGTATGG - Intergenic
1110158894 13:72352140-72352162 GCAGAGATGATGAGGGTGGATGG + Intergenic
1110556533 13:76866023-76866045 GCTGGGAAGGGGAGGGTGGAGGG - Intergenic
1110575610 13:77051874-77051896 GCTGCGATGCTGAGGCTGGACGG - Exonic
1110619140 13:77576091-77576113 GCTGAGATGGAAAGAGAGGAAGG - Intronic
1111122825 13:83877679-83877701 GCTGGGGCGGGGAGGGTGGGTGG + Exonic
1111598951 13:90447175-90447197 GCTGGAGTGGAGAAGGAGGATGG - Intergenic
1111792899 13:92881259-92881281 TCTGGGATGGGGAAGCTGGAAGG - Intergenic
1111899105 13:94179327-94179349 TTTGAGATAGAGAGGGTGGATGG + Intronic
1112470027 13:99679719-99679741 AATGGGAAGGAGAGGGTGGGGGG + Intronic
1113479771 13:110611973-110611995 GCCGAGATGGAAAGGGGGGATGG + Intergenic
1113521043 13:110941130-110941152 GGTGGGGTGGAGGGGGTGGGCGG + Intergenic
1113582828 13:111440794-111440816 GCGGGGATGGAGAGGTGGGAAGG - Intergenic
1113596906 13:111539996-111540018 GCTGGGATGGTGAGGGTAGAGGG - Intergenic
1114149142 14:20015390-20015412 GCTGGGAAGGAGAAGGGTGAGGG + Intergenic
1114260955 14:21035838-21035860 GCTGGGATTGGGGAGGTGGAGGG - Intronic
1114652209 14:24292415-24292437 CCTGGGAAGGACAGGGTGGGTGG - Intronic
1115426826 14:33270158-33270180 ACTAGGAAGGAGAGGGTGGTAGG - Intronic
1116240076 14:42329394-42329416 GCTGGGGTGGAGAGGCAGGAAGG - Intergenic
1116683170 14:48003007-48003029 GCTTGAAGGGTGAGGGTGGAGGG + Intergenic
1116879407 14:50149492-50149514 GCTGGGAAGGATTGGGAGGAGGG + Intronic
1117516028 14:56502140-56502162 GCTGGGGTGTGGAGGGTGGAGGG - Intronic
1118124360 14:62883675-62883697 GATGGGATAATGAGGGTGGAGGG + Intronic
1118137367 14:63045039-63045061 GATGGGATGGGGAGGATGGGGGG + Intronic
1118315797 14:64725370-64725392 GCTGGGATGGTGGTGGTGGGTGG + Intronic
1118470953 14:66074944-66074966 GAAGGGATGGGGAGGGAGGAAGG - Intergenic
1118746227 14:68775496-68775518 GCTGAAATGGTGAGGGTGAAGGG - Intergenic
1118774087 14:68962529-68962551 GCTGGGGTGTGGAGGGAGGAGGG - Intronic
1118894319 14:69932772-69932794 GCTGTGATGGAGTGGGCGGGGGG + Intronic
1119062034 14:71484986-71485008 GCTGGGATGGAGTAAGGGGAGGG - Intronic
1119195548 14:72714578-72714600 GTTGGGATGAAGACGGTGTAAGG - Intronic
1119198299 14:72733565-72733587 GGATGGATGGAGAGGGTGGTTGG - Intronic
1119253697 14:73179884-73179906 AGTGGGATAGAGAGAGTGGAAGG + Intronic
1119548894 14:75493655-75493677 GCGGGGATGGAGAGTGGGGAGGG + Intergenic
1119739961 14:77007929-77007951 TCTGGGAAGGAGAGGGTAGGAGG - Intergenic
1119757873 14:77131550-77131572 AATGGGAGGGAGAGGGAGGAGGG - Exonic
1119768693 14:77206630-77206652 GATGGGGAGGAGAGGGTGGAGGG - Intronic
1119780790 14:77275665-77275687 GCAGGGAAGGAGAGGAGGGATGG - Exonic
1119904967 14:78293448-78293470 GGTGGGATGGAGTAGGGGGATGG - Intronic
1120093900 14:80366064-80366086 GCTGTGGTGGGGAGGTTGGAAGG - Intronic
1120598113 14:86465581-86465603 GGAGGGAGGGAGAGGGAGGAAGG + Intergenic
1120857228 14:89223206-89223228 GATGGGAGGCCGAGGGTGGAAGG + Intronic
1121241457 14:92433135-92433157 GCTGGTGTGGTGAGGGTGGGTGG + Intronic
1121304377 14:92896959-92896981 GGTGGGCTGGGGAGAGTGGAGGG - Intergenic
1121311258 14:92936374-92936396 GCAGTGGTGGAGAGGGTGCAGGG + Intergenic
1121447488 14:93988085-93988107 GATGGGAGGAAGGGGGTGGAAGG + Intergenic
1121517047 14:94559568-94559590 GCTGGGATGGGAAGGGAAGAAGG + Intergenic
1121561699 14:94880891-94880913 GCTGGGAGGACGTGGGTGGAGGG + Intergenic
1122011311 14:98751299-98751321 GGATGGATGGAGTGGGTGGATGG + Intergenic
1122405500 14:101498422-101498444 GCTGAGATGGAGACGGTGCGAGG - Intergenic
1122786964 14:104168364-104168386 GCTGCCCTGGAGAGGTTGGAGGG - Intronic
1122865554 14:104602446-104602468 TCTGGGAAGCTGAGGGTGGAGGG - Intronic
1123032390 14:105458164-105458186 GCTGGGACGGGGAGGGGGAAGGG - Intronic
1202834117 14_GL000009v2_random:65180-65202 TCTGGGGTGGAGAGGGTTGGAGG + Intergenic
1202852581 14_GL000225v1_random:30708-30730 GCTGGGCTGGAGCAGGGGGACGG - Intergenic
1202853651 14_GL000225v1_random:37000-37022 GCTGGGCTGGAGCACGTGGACGG - Intergenic
1123505403 15:20938237-20938259 GCTGGGAAGCATAGGGTGCAGGG - Intergenic
1123562642 15:21511947-21511969 GCTGGGAAGCATAGGGTGCAGGG - Intergenic
1123598887 15:21949231-21949253 GCTGGGAAGCATAGGGTGCAGGG - Intergenic
1124216723 15:27813313-27813335 GCTGGGGTCAGGAGGGTGGAGGG - Intronic
1124633563 15:31350960-31350982 GCTGGGAGGGAGTGTGTGGATGG + Intronic
1125327279 15:38548915-38548937 ACTGGGACAGAGAGGGTGGGGGG + Intronic
1125594566 15:40876070-40876092 GCAGAGGTGGAGAAGGTGGAAGG + Intergenic
1125694199 15:41621693-41621715 GGGGGGAAGGAGAGGGTGGCGGG + Intronic
1126075604 15:44906276-44906298 GCTGGGATGTTGAGGCTGCAGGG - Intergenic
1126344235 15:47675938-47675960 GATGGAATGGGGAGGGGGGAGGG + Intronic
1126361744 15:47853583-47853605 GGAGGCATGTAGAGGGTGGAAGG - Intergenic
1126427652 15:48546772-48546794 GGTGGCATAGAAAGGGTGGAAGG + Intronic
1126695378 15:51321339-51321361 GCTGGGAAGGAAAGTGTGGTGGG - Intronic
1127055225 15:55124724-55124746 GCTGGGATGCAGAAGATGCAGGG + Intergenic
1127098012 15:55533315-55533337 GCTGGAATGGTAAGGGAGGAAGG - Intergenic
1127128263 15:55834860-55834882 GCAGGGATGGAGAAGCTTGAGGG - Intronic
1127262928 15:57339025-57339047 GCTGGGATAGATAGGGGGGCAGG - Intergenic
1127378443 15:58406758-58406780 GTGGGGATAGTGAGGGTGGAGGG - Intronic
1127399624 15:58573078-58573100 GAAGGGATTGAGAGGGAGGAGGG - Intergenic
1128699032 15:69790458-69790480 GCTGGGATGGAGTCAATGGAGGG + Intergenic
1128929175 15:71688955-71688977 GCCGGGATGGAGAGGAGGCAGGG - Intronic
1129312904 15:74725039-74725061 CCTTGGGTGGACAGGGTGGATGG - Intronic
1129965338 15:79729925-79729947 GCAGGGATTGAGAGAATGGAAGG + Intergenic
1130140419 15:81221581-81221603 CCTGGCATCGAGAGGGAGGAAGG - Intronic
1130736938 15:86560281-86560303 GCGGGGGTGGGGAGGGGGGAGGG - Intronic
1131054546 15:89367819-89367841 GCCGGGAGGGCGAGGGAGGAAGG + Intergenic
1131152225 15:90054298-90054320 GATGGGATGGAGAAGGCGGAGGG + Intronic
1131181963 15:90246439-90246461 GCTGTAATGGGGAGGATGGATGG + Intergenic
1131375599 15:91920464-91920486 GGTAGGATGGAGAGAGAGGAAGG + Intronic
1131398497 15:92105754-92105776 GCTGGGATGCAGAAGGGAGATGG + Intronic
1131969909 15:97881595-97881617 GATGGGGTGGAGAGTGAGGATGG - Intergenic
1202970992 15_KI270727v1_random:239080-239102 GCTGGGAAGCATAGGGTGCAGGG - Intergenic
1132462046 16:60363-60385 GCTGTGGTGCAGAGGGTGTAGGG - Intronic
1132873993 16:2127928-2127950 GCAGGGAGGGAGAGGTGGGAGGG + Intronic
1132874004 16:2127955-2127977 GCAGGGAGGGAGAGGTGGGAGGG + Intronic
1132874015 16:2127982-2128004 GCAGGGAGGGAGAGGTGGGAGGG + Intronic
1132874026 16:2128009-2128031 GCAGGGAGGGAGAGGTGGGAGGG + Intronic
1132874037 16:2128036-2128058 GCAGGGAGGGAGAGGTGGGAGGG + Intronic
1132874048 16:2128063-2128085 GCAGGGAGGGAGAGGTGGGAGGG + Intronic
1132874070 16:2128116-2128138 GCAGGGAGGGAGAGGTGGGAGGG + Intronic
1132874081 16:2128143-2128165 GCAGGGAGGGAGAGGTGGGAGGG + Intronic
1132874092 16:2128170-2128192 GCAGGGAGGGAGAGGTGGGAGGG + Intronic
1132874103 16:2128197-2128219 GCAGGGAGGGAGAGGTGGGAGGG + Intronic
1132874114 16:2128224-2128246 GCAGGGAGGGAGAGGTGGGAGGG + Intronic
1132874125 16:2128251-2128273 GCAGGGAGGGAGAGGTGGGAGGG + Intronic
1132874136 16:2128278-2128300 GCAGGGAGGGAGAGGTGGGAGGG + Intronic
1132874147 16:2128305-2128327 GCAGGGAGGGAGAGGTGGGAGGG + Intronic
1132874158 16:2128332-2128354 GCAGGGAGGGAGAGGTGGGAGGG + Intronic
1133302812 16:4793169-4793191 GCCTGGAAGCAGAGGGTGGAGGG + Intronic
1133383163 16:5347898-5347920 GATGGGGGGGAGGGGGTGGATGG - Intergenic
1133469258 16:6058341-6058363 TCTGAGAAGGAGAGGGAGGAAGG - Intronic
1133512295 16:6471823-6471845 GCAGGGATGCAGAGTGTGGTTGG + Intronic
1133597273 16:7304602-7304624 GTTGCGATGGAAAGGGTGGATGG + Intronic
1133598523 16:7316720-7316742 GCTGAGATGGAGTGGGAGGTAGG + Intronic
1133798633 16:9066907-9066929 GCGGTGATGGAGAGGGGAGATGG - Intergenic
1134325330 16:13202157-13202179 GTGGGGTTGGAGAGGGTGGCAGG - Intronic
1134451834 16:14368455-14368477 GCTGGGGTGGTGGGGGTGGGGGG + Intergenic
1134553080 16:15147102-15147124 GCAGGGAGGGAGAGGTGGGAGGG + Intergenic
1134553091 16:15147129-15147151 GCAGGGAGGGAGAGGTGGGAGGG + Intergenic
1134553102 16:15147156-15147178 GCAGGGAGGGAGAGGTGGGAGGG + Intergenic
1134674430 16:16079440-16079462 GCTGAGATGGACAAAGTGGAGGG + Exonic
1134803074 16:17103521-17103543 GATGGGAGGGAAAGGATGGATGG + Exonic
1134880903 16:17744979-17745001 GCTGGGAGGGAGGGGCTGGGTGG + Intergenic
1134885455 16:17786914-17786936 GCAGTGAGGGTGAGGGTGGAGGG - Intergenic
1135046041 16:19156555-19156577 GCTGGAATGGAGTGAGGGGATGG + Intronic
1135163698 16:20120159-20120181 GGAGGGAGGGAGAGGGAGGAAGG - Intergenic
1135541120 16:23331126-23331148 GCTGTGTTGAAGAGGGTGGCAGG + Intronic
1135932180 16:26747610-26747632 AGTGGGATGGAGAGGGAGGGGGG - Intergenic
1136141443 16:28291690-28291712 GCCTGGATGAAGTGGGTGGATGG - Intergenic
1136690271 16:32023804-32023826 GCTGGGATGGGTGGGGTGGCAGG - Intergenic
1136769728 16:32825715-32825737 GTGGGGTGGGAGAGGGTGGAGGG + Intergenic
1136790860 16:32967368-32967390 GCTGGGATGGGTGGGGTGGCAGG - Intergenic
1136798370 16:33045438-33045460 GTGGGGTGGGAGAGGGTGGAGGG - Intergenic
1136878955 16:33886564-33886586 GCTGGGATGGGTGGGGTGGCAGG + Intergenic
1136910672 16:34141847-34141869 GCTGGGCTGGAGCGGGGGGAAGG + Intergenic
1136910774 16:34142555-34142577 GCTGGGCTGGAGAGGGGGAGAGG - Intergenic
1137027459 16:35492298-35492320 GTTGGGAGGCGGAGGGTGGAGGG - Intergenic
1137445749 16:48531116-48531138 GCAGAGATGGAGAGGGTGTCTGG + Intergenic
1137593811 16:49710559-49710581 CCGGGGATGGAGAGGATGCAGGG - Intronic
1138048911 16:53755292-53755314 GCAGGGCTGGAGAGCTTGGACGG + Intronic
1138121581 16:54404629-54404651 GCTGGGATAGAGAGGAGGCAGGG - Intergenic
1138207011 16:55132655-55132677 GATGGGAAGGAGAGAGGGGAGGG + Intergenic
1138261259 16:55624750-55624772 GCTGGGAGGAAGAGGTTGCAGGG - Intergenic
1138580724 16:57939130-57939152 GCTGGCAGGGAGAGGCTGGAAGG + Intronic
1138600130 16:58049175-58049197 GCAGGGCTGGAGGGTGTGGAGGG - Intergenic
1139004190 16:62551239-62551261 GCAGGGAGGGAGGGGGAGGAAGG - Intergenic
1139480821 16:67229732-67229754 GCAGGGTTGGAGGGGGTTGATGG + Intronic
1139592744 16:67942582-67942604 GCTGGCCTGCAGCGGGTGGAAGG + Exonic
1139665710 16:68454029-68454051 GCCTGGATGGAGAGGGCAGATGG + Intergenic
1139821023 16:69721383-69721405 GGTGGGAGGTAGAAGGTGGAAGG - Intronic
1140188728 16:72796531-72796553 GTGGGGGTGGAGGGGGTGGAGGG + Exonic
1140250171 16:73288208-73288230 GCTGGGGTGGAGAGGTGGGAAGG + Intergenic
1140729868 16:77846057-77846079 TCTGGGATGGAGTGGGTGCTTGG + Intronic
1140743209 16:77960013-77960035 GCTAGGATTTAGAGGATGGATGG - Intronic
1140914647 16:79483036-79483058 GATGGGATGGAGGGAGGGGAGGG - Intergenic
1140914696 16:79483152-79483174 GAGGGGATGGAGGGAGTGGAAGG - Intergenic
1141179351 16:81742031-81742053 GCTGGGAAGGGGAGGAGGGAGGG - Intronic
1141203479 16:81914770-81914792 GCTGGGATGTAGTTGGTGGTTGG + Intronic
1141287966 16:82690211-82690233 GCTGGGGTGGGGTTGGTGGAGGG + Intronic
1141421580 16:83921210-83921232 GATGGGTGGTAGAGGGTGGATGG + Exonic
1141603380 16:85139452-85139474 GCTGGGCTGTAGAGTATGGAAGG + Intergenic
1141615999 16:85209718-85209740 GCTGGGAGGGAGAGTCTGGCAGG + Intergenic
1141694098 16:85611856-85611878 GCGGGGAGGGGGAGGGAGGAAGG + Intronic
1141752190 16:85966062-85966084 AGTGGGCTGGAGAGGGTGGGAGG + Intergenic
1203072145 16_KI270728v1_random:1087820-1087842 GTGGGGTGGGAGAGGGTGGAGGG + Intergenic
1203093063 16_KI270728v1_random:1228825-1228847 GCTGGGATGGGTGGGGTGGCAGG - Intergenic
1203141663 16_KI270728v1_random:1771309-1771331 GCTGGGATGGAGGAGGAGGAGGG - Intergenic
1203141710 16_KI270728v1_random:1771452-1771474 GCTGGGATGGAGGAGGAGGAGGG - Intergenic
1203141842 16_KI270728v1_random:1771910-1771932 CCTGGGATTGAGATGGAGGAAGG - Intergenic
1142706015 17:1694912-1694934 GCGGAGATGGAAAGGATGGATGG + Intergenic
1142836497 17:2591792-2591814 GCAGGGATGGGGAGGTTGGGAGG - Intergenic
1143001734 17:3798992-3799014 GCTGGCCTGGAGAGAGTGGAAGG + Intronic
1143019810 17:3911536-3911558 GCAGGGATGGGAAGGGGGGACGG - Intronic
1143028388 17:3953977-3953999 GCTGGACTGGAGGGGCTGGAAGG - Intronic
1143108507 17:4541152-4541174 GCAGGGCTGGAGACTGTGGAAGG - Intronic
1143289828 17:5820331-5820353 GCTGGGTAGGAGTGGGAGGAGGG - Intronic
1143585547 17:7848640-7848662 GCTGTGGCTGAGAGGGTGGAGGG - Exonic
1143624288 17:8100126-8100148 GGAGGGAGGGAGAGGGGGGAGGG + Intronic
1143780652 17:9227038-9227060 GATGGGAGGAAGAGGTTGGAAGG - Intronic
1145757687 17:27404675-27404697 CCTGGTCTGGAGAGGGAGGAGGG - Intergenic
1145816163 17:27796568-27796590 GCTGGGATGGGCAGGTGGGATGG + Intronic
1146229601 17:31095628-31095650 GCTGGGATAAAGGGGATGGAGGG - Intronic
1146238796 17:31194376-31194398 GCTGGGAAGGATAGGGTGCGGGG + Intronic
1146561140 17:33871598-33871620 ACTAGAATGGAGAGGGTGGGAGG - Intronic
1146636539 17:34510318-34510340 GGTGGGAAGGAGAGAGTGGGTGG + Intergenic
1146666373 17:34707248-34707270 GCTGAGATGAGGAGGGTGGGAGG - Intergenic
1146688340 17:34856656-34856678 GAGGGGTTGGAGAGGATGGAGGG + Intergenic
1146734663 17:35228073-35228095 GCTGGGGTGGGGAGGTAGGAGGG + Intergenic
1146795043 17:35774725-35774747 GCTGGGAGGCAGAGGTTGGGTGG - Intronic
1147153126 17:38529939-38529961 GCTGGGATGGGTGGGGTGGCAGG - Intergenic
1147322707 17:39656007-39656029 GGTGGGATGGGGTGGGTGGGTGG + Intronic
1147868381 17:43569644-43569666 GCTGGGTGACAGAGGGTGGAAGG - Intronic
1147986886 17:44311981-44312003 GCCGGGAAGGAAAGGGGGGAAGG + Intronic
1148107626 17:45127839-45127861 TCATGGGTGGAGAGGGTGGAAGG + Intronic
1148121690 17:45216420-45216442 GCTGGGAGGGAGAGGGTAAAAGG - Intergenic
1148235322 17:45964835-45964857 TGTGGGATGGAGAGGAGGGAGGG - Intronic
1148332404 17:46820306-46820328 GCTGGACTGGAGGGGGTGGGAGG + Intronic
1148445194 17:47733363-47733385 GCTGGGATGGGCAGGGAGCAGGG - Exonic
1148467357 17:47872920-47872942 CCGGGGCTGGAGAGGGCGGAAGG + Intergenic
1148475657 17:47927028-47927050 GCTGGCAAGGTCAGGGTGGAGGG + Intronic
1148682149 17:49480458-49480480 GCTGGGAAGCAGAGGGGAGAAGG + Intergenic
1148737549 17:49873292-49873314 GGTGGGATGCTGAGGGGGGAGGG + Intergenic
1148835293 17:50462771-50462793 GCTGGAGTGGAGAGGGCGGGGGG - Intronic
1149130416 17:53294575-53294597 GGGGGGTTGGAGAGGGTGGTGGG - Intergenic
1149454462 17:56776783-56776805 GCTGGAATGGAGAAGGTGAATGG - Intergenic
1149553079 17:57554447-57554469 GCTGAGGAGGAGAGGGGGGATGG - Intronic
1149631448 17:58128198-58128220 GCTGGGGAGGCTAGGGTGGAAGG - Intergenic
1149856678 17:60088738-60088760 GCTGGCGTGGGGAGGGTGGAGGG + Intergenic
1150128519 17:62653719-62653741 GCTGGGATGGAGGGGCTGTTGGG + Intronic
1150152029 17:62817850-62817872 GCTGGGAAGGATAGTGGGGAGGG + Intergenic
1150219926 17:63490435-63490457 GCTGGGATTGAAAGGCTGGCAGG - Intronic
1150370241 17:64631228-64631250 GGTGGGGTGGAGAGGGAGGGAGG + Intronic
1150424830 17:65068994-65069016 GCTGGGAGGGAGGGGGAGGAAGG - Intergenic
1150481476 17:65514826-65514848 GCTGGCAAGGTCAGGGTGGATGG + Intergenic
1150553235 17:66230427-66230449 GTTGGTATGGGGAGGATGGAAGG - Intronic
1150635616 17:66911250-66911272 GCTGAGATGGAGAAGGTGTTGGG - Intergenic
1150823974 17:68457881-68457903 GCTGGGAGGGAGAGGGAAGAAGG + Intergenic
1150928145 17:69555781-69555803 GCTGGGAAGTAGGGGGTGGGGGG - Intergenic
1151328680 17:73394145-73394167 CCTTGGATGGAGAGGCTGGAGGG + Intronic
1151333077 17:73422611-73422633 CCTGGGGAGGAGACGGTGGAGGG + Intronic
1151422056 17:74005164-74005186 GCTGGGCTTCAGAGGGTGGGTGG - Intergenic
1151539366 17:74757393-74757415 GGAGGGATGTGGAGGGTGGAAGG + Intronic
1151696511 17:75720999-75721021 GCTGGCACGGAGAGCGGGGAGGG + Intergenic
1151747092 17:76017623-76017645 GCTGGGATGGAGATGGAGAAGGG - Intronic
1151986189 17:77545345-77545367 GCTGGGATGGGGAGGGAATAGGG + Intergenic
1152095485 17:78269482-78269504 GCTGGAGAGGAGAGGGTGGACGG + Intergenic
1152257742 17:79249912-79249934 GCTAGGATGGTGAGGCTGGTGGG - Intronic
1152334843 17:79694990-79695012 GCAGGGATGGGCTGGGTGGAAGG - Intergenic
1152462534 17:80449143-80449165 GCTGGGCTGGAGAGACGGGAAGG - Intergenic
1152673380 17:81623116-81623138 GCTGGGAGGCAGAGGTTGCAGGG + Intronic
1152678302 17:81652982-81653004 GCAGGGATGGAGGAGGGGGAAGG - Intronic
1152723640 17:81934831-81934853 CCTGGGAGGGCCAGGGTGGAGGG - Intronic
1152739620 17:82013227-82013249 GAGGGGATGGAGACGGAGGAAGG - Intronic
1152804488 17:82348593-82348615 GCTGGGAAGGAGAGGCTGCCAGG + Intergenic
1152814655 17:82400202-82400224 GCTGGGAGGGGCAGGGGGGAGGG - Intronic
1152825758 17:82463715-82463737 GTCAGGAAGGAGAGGGTGGAGGG + Intronic
1152838915 17:82553790-82553812 GCTGTGACGCAGATGGTGGATGG + Intronic
1152864848 17:82716551-82716573 GCTGGGATTGAGGGGCGGGAAGG - Intergenic
1153278538 18:3392553-3392575 GCTGGGGTGGTGTGGTTGGACGG + Intergenic
1153328586 18:3848568-3848590 GCTGGGGTGGAGATGGGGGCGGG - Intronic
1153474755 18:5487317-5487339 GCTGGGAAGGATAGGGAGGATGG + Intronic
1153722285 18:7917832-7917854 GCTGGGATGGATAGGGGGAGTGG - Intronic
1153947068 18:10027544-10027566 TCTGGGATGGGGAGGCTGGATGG + Intergenic
1154172307 18:12060880-12060902 GTGGGGATGGAGAGGTTGGGGGG + Intergenic
1154629730 18:16770126-16770148 GATGGGATGGATGGGATGGATGG + Intergenic
1155339417 18:24799019-24799041 GCTGGGATTGGTAGGGTGGTAGG - Intergenic
1155417656 18:25617207-25617229 GCTGGGATGGTGGTGGTGAAGGG + Intergenic
1155440650 18:25858405-25858427 GCTGGGAAGGGTAGGGGGGAGGG + Intergenic
1155464642 18:26120956-26120978 CCTGGGATGGAGTGCCTGGAGGG + Intergenic
1155910325 18:31498131-31498153 GCGGGGAGGGAGAGGGTGGCCGG + Exonic
1156738353 18:40292256-40292278 GGGGGGATGGGGAGGGAGGAAGG - Intergenic
1157293704 18:46427144-46427166 CTGGGGATGGAGATGGTGGAGGG + Intronic
1157331189 18:46704962-46704984 GCTGGGAAGGAGAGGGGAGGAGG + Intronic
1157555844 18:48612446-48612468 GATGGGAAGGAGAGAGGGGATGG + Intronic
1157557287 18:48621274-48621296 GCTGGCATGGAGGGGAGGGAGGG + Intronic
1158393439 18:57061958-57061980 TCAGGGATGGAGTGGGTGCAAGG + Intergenic
1158843697 18:61417648-61417670 GCTGGGAAGGGTAGTGTGGAGGG + Intronic
1158881015 18:61779709-61779731 GCTGGGATGGAGCTGGGGGTTGG - Intergenic
1159095252 18:63894515-63894537 GGTGGGATGGGGTGGGTGGCTGG + Intronic
1159945129 18:74438988-74439010 CCAGGAATGTAGAGGGTGGAAGG - Intronic
1160134926 18:76263691-76263713 GCTGGGGAGGAGAGGGAGGCAGG - Intergenic
1160317316 18:77859757-77859779 GCTGAGAGAGAGAGGCTGGAGGG + Intergenic
1160321434 18:77900004-77900026 GCTCAGCTGGAGAGGGTAGAGGG - Intergenic
1160377771 18:78426783-78426805 TCTGGGATGGGTAGGGGGGAGGG + Intergenic
1160394019 18:78559016-78559038 GCTGGGGAGGAGGGGGTGGGAGG - Intergenic
1160486628 18:79299298-79299320 GAAGGGCTGGAGAGGGAGGAGGG - Intronic
1160924804 19:1538819-1538841 CCTGGCATGGAGTGGGTGAAGGG + Intergenic
1161042192 19:2116150-2116172 GCTCGGGTGGTGAGGGTAGAGGG + Intronic
1161100545 19:2419043-2419065 GAAGGGAAGGAGAGGGTGGGAGG - Intronic
1161202963 19:3025961-3025983 GCTGGGAAGGAGAAGGGGGTGGG - Intronic
1161210457 19:3062682-3062704 GCCGGGTAGGAGAGGGTGGCGGG - Exonic
1161503190 19:4628979-4629001 GCTGGCTTGGAGATGGAGGAAGG - Intergenic
1161621746 19:5301389-5301411 CCTGGGAGGCAGAGGGTGCAGGG - Intronic
1161636216 19:5390892-5390914 GGGGAGATGGAGAGGGGGGAGGG - Intergenic
1161845522 19:6709895-6709917 CCTGGGATGGAGTGGGTGCTGGG + Intronic
1162057305 19:8072203-8072225 GCCAGGATGGGCAGGGTGGAGGG + Intronic
1162153807 19:8663467-8663489 ACTGAGATGGGGAAGGTGGAGGG + Intergenic
1162153825 19:8663525-8663547 ACTGAGATGGGGAAGGTGGAGGG + Intergenic
1162186976 19:8913460-8913482 GTGGGGCTGGAGAGGGAGGATGG + Exonic
1162369832 19:10271872-10271894 GCTGGGCTGGAGCTGGGGGAGGG - Intronic
1162736135 19:12748143-12748165 GAGGGGGTGGGGAGGGTGGAGGG - Exonic
1162823221 19:13235918-13235940 GTTGGGAGAGAGAGGGTGGGAGG + Intronic
1162825616 19:13249745-13249767 GCTGAGGTGGAGGGGGAGGATGG + Intronic
1162929997 19:13952868-13952890 GCTGGGATGGAGGGGGTTGGGGG + Intronic
1163178669 19:15583653-15583675 CCCGGGATGGAGAAGGCGGAAGG - Intergenic
1163376923 19:16938744-16938766 GATGGGAGGAAGAGGGTGGCTGG - Intronic
1163463680 19:17454536-17454558 GCTAGGATGGAGCGAGTGGCAGG - Intronic
1163551303 19:17967531-17967553 CCTGGGAGGGGGAGGGTGCAGGG + Intronic
1163559502 19:18010374-18010396 GCTTGCATGCAGAGGGTGGGTGG + Intronic
1163635733 19:18436505-18436527 GGGAGGATGGAGAGGGTGTAGGG + Intronic
1163715600 19:18870482-18870504 GCAGAGTTGGAGGGGGTGGAGGG + Exonic
1163815751 19:19463514-19463536 GCGGGGGTGGACAGGGTGGCCGG + Intronic
1164250390 19:23470522-23470544 GCTGGGAAAGAGAGGGCAGAAGG - Intergenic
1164323929 19:24176130-24176152 ACTGTGGTGGAGAGGGGGGAAGG - Intergenic
1164466565 19:28491946-28491968 GCTGGGATGGATAGTGGGAAAGG + Intergenic
1164677028 19:30107711-30107733 GCTGTGAGGGAGAAGGTGCAAGG - Intergenic
1164738263 19:30558388-30558410 GCTGGGGTGGTGGGGGTGGAGGG + Intronic
1165077704 19:33290017-33290039 GCTGGGAGGTAGAGGATGGTAGG - Intergenic
1165101997 19:33444538-33444560 GATTGGATGCAGGGGGTGGAAGG - Intronic
1165144887 19:33724678-33724700 GCAGGGAAGGAGAGGGGGCAGGG - Intronic
1165223885 19:34340586-34340608 GATGGGATGGATAGCATGGATGG - Intronic
1165334084 19:35156898-35156920 GCTGGGATGTCCAGGCTGGAGGG + Intronic
1165462427 19:35952010-35952032 GCTACCATGGGGAGGGTGGATGG + Intergenic
1165667738 19:37648243-37648265 GCTGGGAAGGTGGGGATGGAGGG - Intronic
1165670269 19:37672388-37672410 GGAGGGATGGATAGGGGGGAGGG + Intronic
1165896888 19:39146880-39146902 GGAGGGAGGGAGAGGGGGGAAGG + Intronic
1166251066 19:41571073-41571095 GCTGGCATTGAGTGGGTGGATGG - Intronic
1166320542 19:42015876-42015898 GCTGGGAATGTGAGGGTGGGAGG - Intronic
1166409397 19:42546741-42546763 ACAGGGTTGGGGAGGGTGGAAGG + Intronic
1166618868 19:44277100-44277122 GTTGGGATGGATAGGGGTGAGGG - Intronic
1166670634 19:44707728-44707750 GCTGGGAAGGAGACTGAGGAAGG - Intronic
1166845671 19:45726724-45726746 GCTGGGATTAACAGGGTGGCAGG - Intronic
1167097960 19:47385389-47385411 GCTGGGCTGCAGCGGGTGGAGGG - Intergenic
1167300814 19:48676400-48676422 GGTGGGAGGGAGGGGGTGAAGGG + Intergenic
1167622293 19:50566932-50566954 GCGGGGAGGGAGTGGGAGGAGGG + Intronic
1167624800 19:50580632-50580654 GCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1167636705 19:50659784-50659806 GCGGGGTTGGGGAGGGTGTAGGG - Intronic
1167642703 19:50690561-50690583 ACTGGGATTGTGAGGGTGGGAGG - Intronic
1167698778 19:51030221-51030243 GCAGGGAGAGAGAGGGAGGAAGG - Intronic
1167699558 19:51034496-51034518 GCTGAGATGGGGAGGGTGGTGGG + Intronic
1167715833 19:51142400-51142422 TGGGGGAGGGAGAGGGTGGAAGG + Exonic
1167739673 19:51316939-51316961 CCTGGGAGGTAGGGGGTGGAGGG - Intronic
1167786603 19:51643101-51643123 ACAGGGCTGGAGATGGTGGATGG + Exonic
1168181427 19:54665017-54665039 GCTGGGCTGGTGAGGGGTGAGGG + Intronic
1168290099 19:55353393-55353415 GCTGGAATGGAGAGGGAGAAGGG + Exonic
1168307828 19:55445087-55445109 AAAGGGATGGAGGGGGTGGATGG + Intergenic
1168644506 19:58051481-58051503 GCTGGGCTAGAGACGGAGGAGGG - Intronic
1202638564 1_KI270706v1_random:62512-62534 TCTGGGGTGGAGAGGGTTGGAGG - Intergenic
925611596 2:5706456-5706478 GCTGGGGTGGAGAAGCTGGGAGG + Intergenic
925700268 2:6629659-6629681 GCTAGGATGGAGAGTATGCACGG - Intergenic
925797310 2:7560334-7560356 GCTGGAAAGGGTAGGGTGGAGGG + Intergenic
925871115 2:8271573-8271595 GCTGGCATGGGTAGAGTGGAAGG + Intergenic
926043765 2:9694668-9694690 GCTGGGGTGGGCAGGGTGGGGGG + Intergenic
926340555 2:11901419-11901441 GCTGGCATGGAAGGGGTGCAGGG - Intergenic
926761526 2:16282694-16282716 GTGGGGATAGAGAGGATGGAGGG + Intergenic
926761902 2:16285467-16285489 GCCTGGGAGGAGAGGGTGGAGGG + Intergenic
926849361 2:17178087-17178109 CCTAGGGTGGAGAGGGTAGAAGG - Intergenic
926920730 2:17937390-17937412 GAAGGGATGGAGAGTGGGGAAGG - Intronic
927149141 2:20185830-20185852 GCTGGGAGGGAATGGTTGGAAGG + Intergenic
927244583 2:20947201-20947223 GGTGGGATGGAGGGGTTGGGTGG + Intergenic
927248007 2:20973539-20973561 GCTGGGGTGGACAGGGTGGGAGG + Intergenic
927466802 2:23342892-23342914 GGTGGGCTGGAGAGCGAGGAAGG + Intergenic
927492032 2:23527054-23527076 GCTAGGATGGGGAGTGGGGATGG + Intronic
927879315 2:26679545-26679567 GCTGGGCTGGAGAGGTAGGCAGG + Intergenic
927949721 2:27159318-27159340 GCTGGGATGTAGGAGGTGGGTGG - Intergenic
927954877 2:27201204-27201226 GCTGGGATGTAGGAGGTGGGTGG - Intronic
928023698 2:27723000-27723022 CCTGGGATGCAGAGGTTGAAGGG - Intergenic
928555798 2:32423668-32423690 GCAGGGATTGGGGGGGTGGATGG - Intronic
928879525 2:36082362-36082384 GCTGGGATGGCCAGAGTGGGAGG - Intergenic
928879535 2:36082420-36082442 GCTGGGATGGGCAGAGTGGGAGG - Intergenic
928930644 2:36620333-36620355 GCTGGGAAGTACAAGGTGGAGGG - Intronic
929078441 2:38097720-38097742 GCTGGGAAGGAGAGGCTGGGTGG - Intronic
929178693 2:39008962-39008984 GGTGGGGCGGAGGGGGTGGAAGG + Intronic
929656304 2:43735419-43735441 GCTGGGTAGTAGGGGGTGGAGGG + Intronic
929747779 2:44676683-44676705 ACTGGCATGGAGAGGACGGAAGG + Intronic
929778885 2:44944773-44944795 GAGGGGAAGGAGAGGGAGGAGGG - Exonic
929948727 2:46389833-46389855 GCTGGGAAGGAGGGGGCGGCCGG + Intergenic
930578361 2:53180265-53180287 GCAGGGATGGAGGGGATGGGAGG + Intergenic
930667563 2:54114999-54115021 GCTGGGATGGAGTGGGGTGGGGG + Intronic
930872699 2:56184438-56184460 GCGGGGATGGCGAGGTAGGATGG + Exonic
930991360 2:57659749-57659771 GCTTTGAGGGAGAGGGTGGGAGG - Intergenic
931142720 2:59481046-59481068 GGTGGGAGGGAGAGGCTAGAAGG + Intergenic
931838151 2:66121436-66121458 TGTGGGATGGAGAGTGTAGATGG - Intergenic
932453065 2:71828138-71828160 GCAGGGATGGAGGGGCTGGGTGG - Intergenic
932794544 2:74682989-74683011 GTTGGGATGCAGAGGGAGCAGGG - Intronic
933127927 2:78634305-78634327 GCCGGGAGGGAGAGGGAGGGAGG + Intergenic
933436990 2:82260882-82260904 GCTGGGAAAGAGAGAGAGGAGGG + Intergenic
934077973 2:88443801-88443823 CGGGGGATGGAGAGGGTGGTGGG + Intergenic
934679022 2:96269364-96269386 GATGGGATGGGGTGGGGGGATGG - Intronic
934775088 2:96932269-96932291 GCTGGGTAGGAGAGGGGAGAAGG - Intronic
934854224 2:97718911-97718933 GCTGGGTTGGAGAAGATGGAGGG + Intronic
934937071 2:98473190-98473212 GGTGGAGTGGAGAGAGTGGAGGG + Intronic
936052149 2:109232608-109232630 GAAGGGATGGACAGGGTAGAAGG - Intronic
936289595 2:111211309-111211331 CCTGGGATGCAGAGGTTGCAGGG - Intergenic
937084899 2:119164987-119165009 GCTGGGGTGGGTAGGGTGGGAGG + Intergenic
937223996 2:120357763-120357785 GCTGGGAATGGGAGCGTGGAAGG + Intergenic
937820603 2:126306271-126306293 GCTGAGTTGGGGAGGGTAGAAGG - Intergenic
937955617 2:127420346-127420368 GCTGTGCTGGATAGTGTGGACGG - Intronic
938004943 2:127781311-127781333 GGGGGGTAGGAGAGGGTGGATGG + Intronic
938291822 2:130154641-130154663 GCTGACATGGGGAGGGCGGATGG + Intronic
938342023 2:130541914-130541936 GCTGGGATGGGTGGGGTGGGAGG + Intronic
938347809 2:130578797-130578819 GCTGGGATGGGTGGGGTGGGAGG - Intronic
938464726 2:131518323-131518345 GCTGACATGGGGAGGGCGGATGG - Intergenic
938501061 2:131831529-131831551 GGTGGGATGGAGGGGGGAGATGG - Intergenic
938583638 2:132669602-132669624 GCTGGGCTTGAGAGGAGGGAGGG - Intronic
940383482 2:153043572-153043594 GTTGGCATGGAGAGAGAGGATGG + Intergenic
940730327 2:157382028-157382050 GCTGGGAAGGACAGGGGGAAGGG + Intergenic
940859994 2:158761541-158761563 GCTGGGATGGGGAGGGGGAATGG + Intergenic
940984215 2:160036658-160036680 GCTGGGATGGAGTGGGAAGGAGG + Intronic
941872966 2:170404816-170404838 GCTGGGATGTCCAGGGTAGATGG - Intronic
941939252 2:171016072-171016094 GGTGGGCTGGAGAGTGGGGATGG - Intronic
941940609 2:171033416-171033438 GCTGGGAAGGACAGTGGGGAAGG + Intronic
942575562 2:177360019-177360041 ACTGGTATGGTGAGGGTGGTTGG - Intronic
942610519 2:177737649-177737671 GCTGGGAGGGTGGGAGTGGAAGG + Intronic
944663957 2:201943905-201943927 GCAGAGATGGAGGAGGTGGAAGG + Intergenic
944831444 2:203536924-203536946 GGGGGGATGGAGAGGGGGGAGGG + Intergenic
945123537 2:206484255-206484277 GTTGGGATGGAGAGGGAGGTTGG + Intronic
946182695 2:217958477-217958499 GCTGGGATGGAGAATGACGATGG + Intronic
946237390 2:218332541-218332563 GCTGAGATGGGGAAGGAGGAAGG - Intronic
946248838 2:218401133-218401155 ACGGGGGTGGAGAGGATGGAGGG + Intronic
947561586 2:231158646-231158668 CCTGGGATGGAGACTGGGGAGGG - Intronic
948227023 2:236319115-236319137 GCTGCGATGAAGAAGGAGGAGGG - Intergenic
948283765 2:236768794-236768816 GCTGGGATGGTGGGGGATGAAGG - Intergenic
948318921 2:237053500-237053522 CCTGGGATCCAGAGGGTGGATGG - Intergenic
948340324 2:237245518-237245540 GCAGGGATGGAGGGGATGCATGG - Intergenic
948347579 2:237311904-237311926 TCTGGGATGGAGGGGATTGAGGG - Intergenic
948408903 2:237743789-237743811 GCTGGGATCCAGAGGTTTGACGG + Intronic
948458667 2:238118836-238118858 GGTGGAAGGAAGAGGGTGGATGG + Intronic
948458765 2:238119218-238119240 GGTGGAAGGAAGAGGGTGGATGG + Intronic
948657641 2:239486583-239486605 GCAGGTAGGGAGAGGGTGGTGGG - Intergenic
948861784 2:240756113-240756135 CCTTGGGTGGAGATGGTGGAAGG - Intronic
949082788 2:242118300-242118322 ATTGGGATGGAGAGGGCTGAAGG - Intergenic
1168892020 20:1300825-1300847 GCTGGGAAGGAGAGAGCAGACGG - Intronic
1168952253 20:1810473-1810495 GCAGGGAAGGAGACGGGGGAGGG - Intergenic
1169191543 20:3661492-3661514 TCAGGGATGGAGAGGGAGCATGG + Intronic
1169341650 20:4800903-4800925 GCTGGGATGTTGTGGGTGGACGG - Intronic
1169757985 20:9063875-9063897 GCAGGGTTGGGGAGGGTGGCTGG + Intergenic
1170258184 20:14370613-14370635 GCTGGGCTGGGGATGGTGGCAGG + Intronic
1171151885 20:22834781-22834803 GGAGGGAGGGAGAGGGAGGAAGG - Intergenic
1171178985 20:23077589-23077611 GAAGGGAGGGAGAGGGAGGAGGG - Intergenic
1171178993 20:23077607-23077629 GAAGGGAGGGAGAGGGAGGAAGG - Intergenic
1171262872 20:23748648-23748670 GATGGGGTGGTGAGGGAGGAGGG - Intronic
1171272003 20:23824852-23824874 GATGGGGTGGTGAGGGAGGAGGG - Intronic
1171780237 20:29410938-29410960 GCTGGGCTGGAGCAGGGGGACGG + Intergenic
1171813108 20:29761761-29761783 GCTGGGCTGGAGCGGGGGAACGG - Intergenic
1171824201 20:29879202-29879224 GCTGGGCTGGAGCAGGGGGATGG + Intergenic
1171906127 20:30900555-30900577 GCTGGGCTGGAGCGGGGGGAAGG + Intergenic
1171987399 20:31670186-31670208 GCTAGGATGGAGAGGGAGACAGG - Intronic
1172122427 20:32606335-32606357 TCTGGGATGAGGAGGGTTGAGGG - Intronic
1172577395 20:36019705-36019727 GCTGAGATGGAGGGCTTGGAAGG + Intronic
1172581970 20:36055550-36055572 GACGGGCTGGGGAGGGTGGATGG - Intergenic
1172624797 20:36340816-36340838 GCTGCGATCCAGCGGGTGGAGGG + Intronic
1172827465 20:37802346-37802368 GATGGGATGAAGAGGGTAGGGGG + Intronic
1172873226 20:38148508-38148530 GCTGGGTTGGAGGGGGACGAGGG - Intronic
1173522790 20:43711858-43711880 GCTGGGCTGGATGTGGTGGATGG + Intronic
1173565042 20:44032506-44032528 GATGTGATGGAGAGGGGTGATGG + Intronic
1173750044 20:45469661-45469683 GCGGGGAAGGGGAGGGTGGAGGG - Intergenic
1173825040 20:46042829-46042851 GCTGGTTTGGGGTGGGTGGAGGG + Intronic
1174145458 20:48449934-48449956 GATGGGATGGATGGGATGGATGG + Intergenic
1174145489 20:48450027-48450049 GATGGGATGGAATGGATGGATGG + Intergenic
1174306783 20:49619090-49619112 GATGGGATGGATGGGATGGATGG + Intergenic
1174499055 20:50970848-50970870 GCTGGAAGGGAGATTGTGGAAGG - Intergenic
1174568371 20:51483594-51483616 GGTGGGGGGGAGAGGGTGGAAGG - Intronic
1174789524 20:53464536-53464558 GCTGGGAGGTAGAGGCTGCAGGG - Intronic
1174896056 20:54451397-54451419 GCTGAGTTTGAGAGGGCGGAGGG + Intergenic
1175129083 20:56775800-56775822 GATGGGAGGGAGAGGTGGGAGGG + Intergenic
1175519025 20:59587896-59587918 GCAGGAGTGGACAGGGTGGAAGG - Intronic
1175569112 20:60005874-60005896 GCTGGGATGGTTAGGGAGGTGGG - Intronic
1175582644 20:60112490-60112512 GCTGGGCTGGGTAGGTTGGAAGG + Intergenic
1175925390 20:62468829-62468851 GCTGGGAGGGAGATGGTGCCTGG + Intronic
1176263232 20:64194340-64194362 GTAGGGATGGGGAGGGTGAATGG - Intronic
1176292210 21:5052382-5052404 GGAGGGAGGGAGGGGGTGGATGG - Intergenic
1176713245 21:10326628-10326650 GCTAGGAGGGGGAGGGAGGAAGG - Intergenic
1177190535 21:17846456-17846478 TCTGGGATGGAGGGAGAGGAAGG - Intergenic
1177662596 21:24105497-24105519 GCTAGGAGGGGGAGGGAGGAAGG + Intergenic
1178007633 21:28240872-28240894 GCTGGGATGGGAAGGGAGAAAGG - Intergenic
1178794149 21:35728106-35728128 GCAGAGATGGAGGAGGTGGAAGG - Intronic
1179086588 21:38223825-38223847 GGTGGGAAGCAGAGGGAGGATGG - Intronic
1179141538 21:38730199-38730221 GCTGGGGTGGAGTTGGTGGGCGG - Intergenic
1179175776 21:39006969-39006991 GCTGGGTGGGACAGGGTGGGAGG - Intergenic
1179289435 21:40005910-40005932 GCTGGGATCCAGAGTGTGGATGG + Intergenic
1179342037 21:40521169-40521191 ACTGGGAGTGAGAGGGTGGGTGG + Intronic
1179632537 21:42687768-42687790 GGTGGGATGGGAAGGGTGGGAGG - Intronic
1179658719 21:42861334-42861356 GGTGGGGTGGGGAGGGGGGAAGG + Intronic
1179865049 21:44211272-44211294 GGAGGGAGGGAGGGGGTGGATGG + Intergenic
1179893328 21:44348786-44348808 GCTGACATGGAGCGGGTGAAAGG + Intergenic
1180144312 21:45910750-45910772 GCTGGGATGGCGGTGGGGGAGGG + Intronic
1180339552 22:11606674-11606696 GCTGGGCTGGAGCGGGGGGAAGG + Intergenic
1180363402 22:11919376-11919398 TCTGGGGTGGAGAGGGTTGGAGG + Intergenic
1180829628 22:18897210-18897232 GCTAGGAGGGGGAGGGAGGAAGG - Intergenic
1180836947 22:18934707-18934729 GCTGGGATGGGGAGGGGGCTAGG - Intronic
1181028239 22:20137810-20137832 GCAGGGCTGGGGAGGGTGGAAGG + Intronic
1181043393 22:20203477-20203499 GCTGGGAGGTGGAGGCTGGAGGG + Intergenic
1181322762 22:22021292-22021314 GCTGGTATGGAGACCATGGAAGG + Intergenic
1181528515 22:23502952-23502974 GGAGGGATGGGGATGGTGGAGGG - Intergenic
1181822746 22:25488097-25488119 GGTGGGATGGGCTGGGTGGATGG + Intergenic
1182130001 22:27843832-27843854 GCAGAGATGGAGAGGGTGGCTGG + Intergenic
1182424957 22:30266919-30266941 GTGGGGATGGGGAGGGGGGAGGG + Intergenic
1182551307 22:31102254-31102276 GGTGGGAGGGAGAGGGAAGATGG + Intronic
1182629847 22:31676801-31676823 GCCGGGCTGGAGAGCGGGGAGGG - Intronic
1182764004 22:32745393-32745415 TCGGGGGTGGAGGGGGTGGATGG + Intronic
1183191760 22:36326119-36326141 GCTGGGGTGGTGGGGGTGGGTGG + Intronic
1183230471 22:36578832-36578854 CCTGTGCTGGAGGGGGTGGATGG + Intronic
1183408109 22:37640216-37640238 GCTGGGCCGGGGAGGGAGGAGGG + Intronic
1183432851 22:37776010-37776032 GGTGGGATGGTGAGGATGGACGG - Exonic
1183509577 22:38227029-38227051 GAAGGGATGGAGGGGATGGAAGG + Intronic
1183619787 22:38965751-38965773 GCTGGGGTGTATTGGGTGGAGGG - Intronic
1183654610 22:39177366-39177388 GAGGGGAGGGAGAGGGTGGGAGG - Intergenic
1183674412 22:39291634-39291656 GCTGGGATGAGGAGGGAGCAGGG + Intergenic
1183689201 22:39378788-39378810 CCTGGGCTGCAGAGGGAGGATGG - Intronic
1183738652 22:39657935-39657957 GCTGAGATGGTGAGGGTTGGGGG - Intronic
1184027706 22:41870254-41870276 GCAGAGATGGGTAGGGTGGATGG - Intronic
1184368997 22:44070749-44070771 GCTGGGCGGGATGGGGTGGATGG + Intronic
1184389231 22:44193377-44193399 GTAGGGAGGGAGAGGATGGAAGG + Intronic
1184652804 22:45926825-45926847 GCCGAGAAGGAGAGTGTGGAGGG + Intronic
1184920417 22:47601618-47601640 GGAGGGATGGAGAAGGAGGAGGG - Intergenic
1185072906 22:48667037-48667059 CCTGGGATTGAGGGGGAGGAGGG + Intronic
1185107690 22:48883579-48883601 CCTGGGAAGGAGAGGGAGTAGGG + Intergenic
1203279719 22_KI270734v1_random:122482-122504 GCTAGGAGGGGGAGGGAGGAAGG - Intergenic
1203287040 22_KI270734v1_random:160006-160028 GCTGGGATGGGGAGGGGGCTAGG - Intergenic
949894358 3:8758243-8758265 GCTGGGGTGGAGAGAGTGCCGGG - Intronic
950112373 3:10427650-10427672 TCTGGGATGGTGAAGGTGGAGGG + Intronic
950190067 3:10970471-10970493 GGTGGGATGGAGAGAGAGGCTGG + Intergenic
950453732 3:13080246-13080268 GTTGGGATGGTGAGTCTGGAGGG + Intergenic
950677577 3:14563984-14564006 GCAGGTCTGGTGAGGGTGGAGGG - Intergenic
950853958 3:16088280-16088302 GGAGGTATGGAGTGGGTGGATGG + Intergenic
950939923 3:16883337-16883359 CCTGGGATGGAGAGGTGGGTGGG + Intronic
950964644 3:17137802-17137824 GCTGGGAAGGAGAGAGCGGGAGG + Intergenic
951222537 3:20083919-20083941 GTTGGGATAGGGAGGATGGAAGG + Intronic
952901379 3:38114167-38114189 GCTGGGAGGGAGAGTGGAGATGG + Intronic
953027182 3:39152109-39152131 GCTGGGATGGAGGGTCTGAAGGG + Intronic
953111349 3:39942807-39942829 GCTGGGAAGGAGATAGTAGAGGG - Intronic
953412670 3:42698993-42699015 GCTGGCAGGGAGAGGCTGGGTGG + Intronic
953458281 3:43061295-43061317 GCTGGGCTGGGGAGTGTGGTGGG - Intergenic
953810337 3:46107435-46107457 TCTGGGCTGGGGAGGGTGGGAGG + Intergenic
953979330 3:47405893-47405915 CCTGGGAGGGAGTGGGAGGATGG - Exonic
954181021 3:48881474-48881496 CCTGGGATGGAGATGGGGGTGGG - Intronic
954245745 3:49330093-49330115 CCTGGGAGGGAGAGGTTGCAGGG + Intronic
954411576 3:50373512-50373534 GCAGGGAGGGGGAGGGAGGAGGG + Intronic
954411806 3:50374222-50374244 GGGGGGATGGTGAGGGTGGGGGG + Intronic
954416530 3:50396033-50396055 GCTGGGCTGGGGAGAGAGGAGGG - Intronic
954433459 3:50483604-50483626 GCTGGGTTGGGGGGAGTGGAGGG + Intronic
954465509 3:50652241-50652263 GCAGGCATGGGGAGGGGGGAGGG + Intergenic
954639358 3:52088879-52088901 GCTGGCTTGGAGATGGGGGAGGG - Intronic
954980026 3:54737512-54737534 CCTGGGAAGAAGAGGGTGGTTGG + Intronic
955201856 3:56858789-56858811 CAAGAGATGGAGAGGGTGGAGGG + Intronic
955408317 3:58639781-58639803 GTTGGGATGGAGATGGAGGAGGG + Intronic
956263332 3:67369570-67369592 GGAGGAAAGGAGAGGGTGGATGG + Intronic
956451074 3:69375225-69375247 GATGGGATGGGGTGGATGGATGG - Intronic
956451082 3:69375247-69375269 GATGGGATGGGGTGGATGGATGG - Intronic
956642612 3:71429093-71429115 GCTGGGGACGAGAAGGTGGATGG + Intronic
956737247 3:72247271-72247293 GCGTGGGTGGGGAGGGTGGAAGG - Intergenic
957219814 3:77367375-77367397 GTTGGGAAGGGGAGAGTGGAAGG - Intronic
957555018 3:81755812-81755834 GCTGGGAAGGACAGTGGGGAAGG + Intronic
958130822 3:89419804-89419826 GCAGGGATGCAGGGGGTGGGAGG - Intronic
959041014 3:101423708-101423730 GCTAGGCTGAAGAGGGAGGAAGG + Intronic
959254652 3:103992925-103992947 GGTGGGATGGAGTGGGAAGATGG + Intergenic
959255227 3:104002280-104002302 GCCGGGATGGAGTCAGTGGATGG + Intergenic
960101506 3:113747142-113747164 GTGGGGATAGAGGGGGTGGAAGG + Intronic
960139078 3:114135076-114135098 GCTAGGAAGGAGATGGGGGAGGG - Intronic
960990015 3:123304195-123304217 GCAGGGGTGGAGAGGGAGGGAGG + Intronic
961004543 3:123396061-123396083 GGTGGGAGGGAGAGGGAGGGAGG + Intronic
961092397 3:124125520-124125542 GCTGTGATGTGGTGGGTGGAGGG + Intronic
961101596 3:124203529-124203551 GCTGGAAGAGAGAGGTTGGAGGG + Intronic
961805221 3:129484276-129484298 CCTGGGGTGCAGAAGGTGGAGGG - Intronic
961987927 3:131157698-131157720 GCTGGGCTGAAGGGGGAGGAAGG + Intronic
961990317 3:131182927-131182949 TGTGGGAGGTAGAGGGTGGAAGG - Intronic
962089701 3:132230374-132230396 ACTGGGGAGGAGAGGGTGGGAGG - Intronic
962222202 3:133573618-133573640 GAGGGGAGGGAGAGGGAGGAGGG - Intergenic
962249725 3:133828629-133828651 GGTGGGATGGGGAGGGAGGCTGG - Exonic
962422162 3:135238338-135238360 GCTGGGATGGAGGGGGGCGGCGG + Intronic
962636494 3:137337365-137337387 CCTGGGAGGGACAGTGTGGAAGG + Intergenic
962685564 3:137844557-137844579 GCTGTGATAGGGAGGGTGGATGG + Intergenic
962752516 3:138444266-138444288 CCTCAGATGGGGAGGGTGGAGGG + Intronic
962942151 3:140134747-140134769 TGGGGGAAGGAGAGGGTGGAGGG + Intronic
963312259 3:143721753-143721775 GCAGTGGTGGAGAGGGAGGAAGG + Intronic
963801831 3:149683844-149683866 GCTGGGGTGGAGATTATGGATGG + Intronic
964073329 3:152662851-152662873 TTTGGGATGGAAAGGGTGGGTGG + Intergenic
964604296 3:158542653-158542675 CCTAGGATGGAAAGGTTGGAAGG + Intronic
965786542 3:172340813-172340835 GCTGGCATGGAGGGAGTGGTAGG - Intronic
966217418 3:177517964-177517986 GCTGGGATGGGGAGAGAGAAGGG + Intergenic
966882909 3:184359979-184360001 GCTGGGATGGGGGGGAGGGAGGG + Intronic
966974207 3:185070598-185070620 GCTGGGAAGGAGTGGGAGGGAGG + Intergenic
967106083 3:186256089-186256111 GCTGATCTGCAGAGGGTGGATGG - Intronic
967194968 3:187018120-187018142 GCTGAGATGGAGAGGCAGGCTGG + Intronic
967257694 3:187610198-187610220 TCTGGGATTGAGAGGAGGGAAGG + Intergenic
967397506 3:189024133-189024155 CCTGGGATGGAGTGCCTGGAGGG - Intronic
967648605 3:191957467-191957489 GGAGGGATGGAGAAGGAGGAAGG + Intergenic
967758932 3:193202286-193202308 CCTGGGAAGGAGAAGATGGAAGG + Intergenic
967884058 3:194321491-194321513 CCTGGGATGCAGAGGTTGCAGGG + Intergenic
968051272 3:195656676-195656698 TCCCGGAGGGAGAGGGTGGAGGG + Intergenic
968104552 3:195991663-195991685 TCCCGGAGGGAGAGGGTGGAGGG - Intergenic
968302843 3:197629246-197629268 TCCCGGAGGGAGAGGGTGGAGGG - Intergenic
968430493 4:555657-555679 GATGGGATGGAGATGGTGTGTGG - Intergenic
968531382 4:1093778-1093800 GCTGGGATGGAGCAGGGTGAGGG + Intronic
968648627 4:1751767-1751789 GCAGGGATGGTGCGGGTGGAGGG - Intergenic
969239450 4:5889118-5889140 GCTAGGATGGAGAGGGTGGCAGG - Intronic
969285189 4:6198782-6198804 GCTGGGATGGGCAAGGAGGAGGG - Intronic
969308846 4:6340528-6340550 GATTGGATGGAGAGGGAGGGAGG - Intronic
969327352 4:6451728-6451750 GCCGGGAGGAGGAGGGTGGAAGG - Intronic
969365133 4:6689910-6689932 GATGGGCTGGAGGGGGAGGAGGG - Intergenic
969492717 4:7509297-7509319 GAGGGGATGGAGAGGGAGAAAGG + Intronic
969500974 4:7552746-7552768 GCTGGAGTGGAGAGGCAGGAAGG - Intronic
969621035 4:8279000-8279022 GAAGGGATGGAGGGGGAGGAGGG - Intronic
969936543 4:10687663-10687685 GCTAGCATGGAGAGGGAGCAAGG + Intergenic
970179436 4:13374701-13374723 GATGGAATGGAAAGGTTGGATGG - Intronic
970572047 4:17392892-17392914 GGGTGGAAGGAGAGGGTGGAAGG + Intergenic
971390541 4:26181428-26181450 GGAGGTATGGAGAGGGAGGAAGG - Intronic
972446615 4:39150415-39150437 CAGGGGATGGAGAGGGAGGAAGG + Intergenic
972542242 4:40049268-40049290 GATGGGATGGATGGGATGGATGG - Intergenic
973131333 4:46652460-46652482 ACTGGGATTGTGGGGGTGGATGG + Intergenic
973259526 4:48148077-48148099 GCTGGGCTGGTGAAGGGGGATGG + Intronic
974469711 4:62302690-62302712 GCTGGAAAGGGGAGGGTAGATGG + Intergenic
974617845 4:64312897-64312919 GCTGGGATAAAGAGATTGGAAGG - Intronic
975252150 4:72192873-72192895 GGTGGGGTGGAGAGGGAAGAAGG + Intergenic
975442077 4:74422300-74422322 GTTGGGGTAGAGAGTGTGGAGGG + Intergenic
977401724 4:96541125-96541147 TCTGGGAAGGAGAGGGCAGAAGG + Intergenic
978008045 4:103642651-103642673 GCTGGGAAGGGTAGGGTGGAGGG + Intronic
978351221 4:107822934-107822956 GCTGGGAAGGGTAGGGGGGATGG - Intergenic
978480981 4:109190417-109190439 GGAGGGAAGGAGAGGGTGAAAGG + Intronic
978504631 4:109443482-109443504 TCTGGGAGGCAGAGGTTGGAGGG - Intronic
979606528 4:122644473-122644495 ACTGGGATGGAGAGGGTCACAGG - Intergenic
979677230 4:123423262-123423284 GGTGGGAAGGGGAGGGTGGGTGG + Intergenic
980030213 4:127819644-127819666 GCTGGCAGGGAGAGGGCTGAAGG - Intronic
980280576 4:130714296-130714318 GGAGGGATGGAGGGGGTGGGGGG - Intergenic
980862310 4:138514171-138514193 GTAGGGATGGAGAGGGAGAATGG - Intergenic
981000519 4:139824857-139824879 GTTGGGATGGAGGGGGTATATGG - Intronic
981093645 4:140757078-140757100 AATGGAATGGAGAGGGGGGAGGG - Intergenic
981098571 4:140806595-140806617 GTTGGGAGGGAGGGGGTTGAGGG + Intergenic
981244408 4:142517110-142517132 CCTGGTATGCAGAGGGTGGAAGG - Intronic
981774177 4:148346083-148346105 GCTGAAATGGAGAGAGGGGAGGG + Intronic
982700519 4:158656199-158656221 ATTGGGATGAAGAGAGTGGAAGG - Intergenic
982754692 4:159204312-159204334 AGTGGGATGTAGAGGGTAGATGG + Intronic
983113513 4:163782591-163782613 ACTGGGAGGGAGAGGTTGCAGGG + Intronic
983696912 4:170543610-170543632 GCTGGGGGGTAGAGGGTGGGAGG + Intergenic
983713488 4:170749208-170749230 ACTTGGAGGGAGAGGGGGGAAGG - Intergenic
983890479 4:173024976-173024998 GCTGGGAGGGAGGGGTTGGCTGG - Intronic
984081959 4:175258021-175258043 GGTGGGGTGGGGAGGGGGGAGGG + Intergenic
985444645 4:190015317-190015339 GCAGGGGCGGACAGGGTGGAGGG - Intergenic
1202765903 4_GL000008v2_random:148371-148393 TCTGGGGTGGAGAGGGTTGGAGG - Intergenic
985516462 5:347854-347876 GCTGGGATGGCCAGAGCGGAGGG - Intronic
985541105 5:488160-488182 GCTGGGAGGAAGGAGGTGGAGGG + Intronic
985604429 5:850769-850791 GCTGGGCTGGAGTCGGTGCAGGG + Exonic
985846896 5:2356448-2356470 GCTGGGACAGAGAGGGAGGAAGG - Intergenic
985943166 5:3155229-3155251 GCTGGGAAGGAGACTGTGGGAGG + Intergenic
985956244 5:3268262-3268284 GCAGGGCTGGAGAGAGGGGAAGG - Intergenic
986006243 5:3671527-3671549 GCTGGGAGAGAGAGGATGGAAGG + Intergenic
986088892 5:4482284-4482306 GCAGGGATGGGGAGCCTGGATGG + Intergenic
986892077 5:12320951-12320973 GCTGGGCTGAAGAGGGAGGAAGG - Intergenic
987320930 5:16768782-16768804 GCTTGGGAGGAGAGGGTGGGAGG - Intronic
987355476 5:17059880-17059902 GGTGGCATGGAGGAGGTGGATGG + Intergenic
987614524 5:20255132-20255154 GGAGGGAAGGAGAGGGAGGATGG + Intronic
988080824 5:26412231-26412253 GCTAGGAAGGAGAAGGTGGGAGG - Intergenic
989102672 5:37836453-37836475 GTTGGGCTCGAGAGGGTGTAGGG + Intronic
989749930 5:44881185-44881207 GGTGGGAGGAAGAGGGCGGAAGG + Intergenic
989828931 5:45890873-45890895 TCTGGGATGGGGAGGCTGGCCGG - Intergenic
990383918 5:55240750-55240772 GCTGAGATGGAAAGGATTGAGGG + Intergenic
990553084 5:56903810-56903832 GTGGAGATGGAGAGGGTGGATGG - Intergenic
990636792 5:57736984-57737006 GCTGGTAGGGAGGTGGTGGACGG - Intergenic
991069525 5:62461209-62461231 GCAGGGATGGAAAGGGTGGGAGG + Intronic
991144398 5:63283832-63283854 GTGGGGACGGGGAGGGTGGAGGG + Intergenic
991597467 5:68320328-68320350 GCTGGGGTGGAGAAGGAGGGAGG + Intergenic
991789250 5:70222072-70222094 GATGGGACGGAGAGGATGGGAGG - Intergenic
992887626 5:81174464-81174486 GCAGAGGTGGAGAGGCTGGAGGG + Intronic
992986966 5:82240507-82240529 GCTGGGAAGGATAGTGAGGAGGG + Intronic
994119341 5:96096415-96096437 GCAGGGATTGAGACAGTGGAGGG - Intergenic
994576861 5:101589309-101589331 GTTGGGGTGGGGAGGGGGGAGGG + Intergenic
994737630 5:103575150-103575172 ACTGGGAGGGAGAGAGAGGAAGG - Intergenic
995381136 5:111534646-111534668 ACTGGGAGGGAGAGAGTAGAAGG + Intergenic
995596002 5:113748324-113748346 GCTGGGATGCAGTGGTGGGATGG - Intergenic
996136098 5:119844188-119844210 GCTGGTATGGTGAGGTGGGACGG + Intergenic
996557709 5:124796301-124796323 GATGGGAAGGTGAGGGTGGAGGG - Intergenic
996767736 5:127051529-127051551 GCAGGGAGGGAGATGATGGAGGG - Intronic
996800418 5:127396813-127396835 GCATGAATGGAGAGGGTGGGTGG - Intronic
997197710 5:131990790-131990812 GCAGGGGTGGAGTGGGTGCAAGG - Intronic
997521625 5:134527201-134527223 GAAGGGAGGGAGAGGGAGGAAGG - Intronic
997576480 5:134981408-134981430 GCTGGGAGGCAGAGGTTGCAGGG + Intronic
997593664 5:135091859-135091881 GCTGGGATGGCAGAGGTGGAGGG - Intronic
997877481 5:137562444-137562466 GCTGGGATGGGGTGGGGGCAGGG - Intronic
998094341 5:139388756-139388778 TCTGGGATGGGGATGGGGGATGG + Intronic
998164725 5:139836484-139836506 CCTGGGATGGAGAGAGGAGAAGG + Intronic
998170067 5:139867482-139867504 GCTGGGATGAATAGGGACGAGGG - Intronic
998460005 5:142302851-142302873 CCCGGGATGGAGAGGTTGTAGGG + Intergenic
998471982 5:142390515-142390537 GGAGAGAGGGAGAGGGTGGAGGG + Intergenic
999251663 5:150185978-150186000 GCTGGGATGTTCAGGCTGGAGGG + Intergenic
999386703 5:151158525-151158547 GCTGGAATGGAGTGAGTGGGAGG + Intergenic
999715364 5:154355930-154355952 GCTGGGAGGTACAGAGTGGAAGG - Intronic
999720570 5:154396352-154396374 GCGGGTATGGAGAGGGTAGGAGG + Intronic
1000245097 5:159442504-159442526 CCAGGGATGTAGAGGGTGGAAGG - Intergenic
1000832135 5:166115967-166115989 GATGGAAGGGACAGGGTGGAAGG - Intergenic
1001089391 5:168726349-168726371 GCAGGGAGGGAGAGGGAGGCAGG + Intronic
1001089398 5:168726367-168726389 GCAGGGAGGGAGAGGGAGGCAGG + Intronic
1001089449 5:168726501-168726523 GCAGGGAGGGAGAGGGAGGCAGG + Intronic
1001143055 5:169161352-169161374 GCAGTGATGGACAGGGTGGGAGG - Intronic
1001223472 5:169924066-169924088 GCAGGGAGGAAGAGGGTGGCAGG - Intronic
1001378213 5:171282977-171282999 GTGGGAATGGAAAGGGTGGATGG - Intronic
1001515944 5:172355374-172355396 GCTGGGCTGGGAGGGGTGGAGGG + Intronic
1001535630 5:172496001-172496023 GGTGGGAGGGTGAGGGGGGAAGG - Intergenic
1001599037 5:172917008-172917030 GCTGGGCTGGAGAGGGTGGCAGG + Intronic
1001737976 5:174022702-174022724 GCTGGGAGGGAGTGGGTGTTTGG + Intergenic
1002025717 5:176395099-176395121 GCTGGGATGGTGGGGATGGTGGG - Intronic
1002134793 5:177100886-177100908 GCTGGCAGGGAGGGGGTGCAGGG - Intergenic
1002135644 5:177105932-177105954 GCAGGGATGGAGAGGATGTGGGG - Intergenic
1002457064 5:179351260-179351282 GCTGGGGTAGAGGGGGTGGTAGG - Intergenic
1002775435 6:324278-324300 GCAGGCGTGGAGAGGGTGGAGGG + Intronic
1002791436 6:440688-440710 GATGGGTGGGAGAGGATGGAAGG - Intergenic
1002791445 6:440715-440737 GATGGGATGGATAGGATGGATGG - Intergenic
1002875405 6:1205120-1205142 GCTGGGATAGAGTGGGTGCTGGG - Intergenic
1002875409 6:1205137-1205159 GCTGGGATAGAGCGGGTGCTGGG - Intergenic
1002875417 6:1205171-1205193 GCTGGGATGAAGTGGGTGCTGGG - Intergenic
1002875421 6:1205188-1205210 GCTGGGATAGAGTGGGTGCTGGG - Intergenic
1002875425 6:1205205-1205227 GCTGGGATAGAGTGGGTGCTGGG - Intergenic
1002875429 6:1205222-1205244 GCTGGGATGAAGTGGGTGCTGGG - Intergenic
1002875433 6:1205239-1205261 GCTGGGATAGAGTGGGTGCTGGG - Intergenic
1002875437 6:1205256-1205278 GCTGGGATAGAGCGGGTGCTGGG - Intergenic
1002875441 6:1205273-1205295 GCTGGGATGAAGTGGGTGCTGGG - Intergenic
1002875445 6:1205290-1205312 GCTGGGATAGAGCGGGTGCTGGG - Intergenic
1002875453 6:1205324-1205346 GCTGGGATAGAGTGGGTGCTGGG - Intergenic
1002875457 6:1205341-1205363 GCTGGGATAGAGCGGGTGCTGGG - Intergenic
1002875461 6:1205358-1205380 GCTGGGATAGAGCGGGTGCTGGG - Intergenic
1002875473 6:1205409-1205431 GCTGGGATAGAGCGGGTGCTGGG - Intergenic
1002875477 6:1205426-1205448 GCTGGGATAGAGCGGGTGCTGGG - Intergenic
1002875489 6:1205477-1205499 GCTGGGATAGAGCGGGTGCTGGG - Intergenic
1002875497 6:1205511-1205533 GCTGGGATGAAGTGGGTGCTGGG - Intergenic
1002875501 6:1205528-1205550 GCTGGGATAGAGCGGGTGCTGGG - Intergenic
1002875505 6:1205545-1205567 GCTGGGATGAAGTGGGTGCTGGG - Intergenic
1002875509 6:1205562-1205584 GCTGGGATAGAGCGGGTGCTGGG - Intergenic
1002875513 6:1205579-1205601 GCTGGGATGAAGTGGGTGCTGGG - Intergenic
1002875517 6:1205596-1205618 GCTGGGATAGAGCGGGTGCTGGG - Intergenic
1002875525 6:1205630-1205652 GCTGGGATAGAGCGGGTGCTGGG - Intergenic
1002875529 6:1205647-1205669 GCTGGGATAGAGTGGGTGCTGGG - Intergenic
1002875533 6:1205664-1205686 GCTGGGATAGAGTGGGTGCTGGG - Intergenic
1002875537 6:1205681-1205703 GCTGGGATAGAGCGGGTGCTGGG - Intergenic
1002875545 6:1205715-1205737 GCTGGGATAGAGTGGGTGCTGGG - Intergenic
1002875549 6:1205732-1205754 GCTGGGATAGAGTGGGTGCTGGG - Intergenic
1002875553 6:1205749-1205771 GCTGGGATAGAGCGGGTGCTGGG - Intergenic
1002875557 6:1205766-1205788 GCTGGGATAGAGCGGGTGCTGGG - Intergenic
1002875564 6:1205800-1205822 GCTGGGATAGAGTGGGTGCTGGG - Intergenic
1002875568 6:1205817-1205839 GCTGGGATAGAGTGGGTGCTGGG - Intergenic
1002875572 6:1205834-1205856 GCTGGGATAGAGTGGGTGCTGGG - Intergenic
1003233130 6:4272618-4272640 GCTGAGATGGCGGGGGTGGGGGG - Intergenic
1003238144 6:4316994-4317016 GCAGGGAGGGAGAGTGAGGATGG + Intergenic
1003287103 6:4744136-4744158 GTTGGGAAGGAGAGTGTCGAGGG + Intronic
1003305473 6:4923223-4923245 GCTGGGAAGTAGTGGGTGGGGGG - Intronic
1003482592 6:6546794-6546816 GCTGGGGTGGTGAGGGCGGATGG + Intergenic
1003864080 6:10347753-10347775 GGTGGAAGGGAGAGGGTGGCTGG + Intergenic
1004020385 6:11771188-11771210 GCTGGGGTGGAGAGGGAGAGGGG - Intronic
1004780962 6:18908112-18908134 GGAGGGTTGGAAAGGGTGGAAGG + Intergenic
1005682125 6:28217924-28217946 GCTGGGATTGAGAGGCCGGTTGG + Intergenic
1005948824 6:30616241-30616263 GCAGGCAAAGAGAGGGTGGAGGG - Intronic
1006155019 6:32009236-32009258 GCTGGGAGGGTGAGGCTGGGAGG - Intergenic
1006161330 6:32041971-32041993 GCTGGGAGGGTGAGGCTGGGAGG - Intronic
1006502173 6:34466078-34466100 GCTGAGGCGGAGAGGGGGGAAGG - Exonic
1006710675 6:36067060-36067082 GCTGAAATGGAGATGGTGGGTGG + Intronic
1006942715 6:37763550-37763572 GATGGGATGGAGAGTGGGGTGGG - Intergenic
1007230241 6:40343143-40343165 GCTGGGGAGGAGAGGTTGGGTGG + Intergenic
1007380783 6:41488825-41488847 GCTGGGAGGGAGAAAGTGGGAGG + Intergenic
1007412863 6:41674906-41674928 GCTGGCATAGAGAAGGTGGGGGG - Intergenic
1007909453 6:45498965-45498987 GCTGTGAGTGTGAGGGTGGATGG + Intronic
1008494278 6:52116922-52116944 GTTTGGATGGTAAGGGTGGAGGG - Intergenic
1009201293 6:60749827-60749849 GCAGTGATGGAGGTGGTGGAGGG - Intergenic
1010372334 6:75125203-75125225 GCTGGGATTGAGATTGTGTAAGG + Exonic
1011083331 6:83512436-83512458 GGTGGGATGGAGTGGGGGGAGGG - Intergenic
1011406230 6:87018168-87018190 GTTGGGATGGGGAGGGAGAAAGG - Intergenic
1012056513 6:94419080-94419102 GCTGGGAAGTGGAGGGCGGATGG - Intergenic
1012291852 6:97466072-97466094 ACTGGGATGGAGAGGGAAGTGGG - Intergenic
1012982595 6:105845958-105845980 GGTGGGATGGAGTGGGGGGTTGG - Intergenic
1013251608 6:108340023-108340045 GCTGGGGTGGAGGGGGAGGTGGG - Intronic
1013298448 6:108781055-108781077 GCAGGCATGGAGTGGGTGGAGGG - Intergenic
1013442968 6:110190432-110190454 GCTGGGATGCAAAGAGAGGAGGG + Intronic
1013601574 6:111710112-111710134 GCTGGGCGGGAGAGGGTGGAGGG - Intronic
1013976276 6:116082380-116082402 ATTGGGATGGAGAGGGATGAGGG + Intergenic
1014091677 6:117411262-117411284 GGGGGGATGGAGAGAGTGGGAGG - Intronic
1014726744 6:124980368-124980390 TCTGGGAAGGGGAGGGTGGTAGG - Intronic
1015645228 6:135379973-135379995 GGAGGGAGGGAGAGGGTGAAGGG - Intronic
1015786285 6:136923276-136923298 GCTGGAATGGAGGTGGGGGATGG + Intronic
1015970805 6:138741225-138741247 GCAGGGATGGGGAGGGAAGATGG - Intergenic
1016866359 6:148771577-148771599 GCTGAGATGGAGTGGGTAGGTGG + Intronic
1017081817 6:150676910-150676932 GCTATGAAGGAGAGGGAGGAGGG - Intronic
1017225678 6:152018581-152018603 GCTGGGGTGTTGGGGGTGGAAGG + Intronic
1017491138 6:154946208-154946230 GTGGGGAAGGGGAGGGTGGAAGG - Intronic
1017725493 6:157273854-157273876 GCTGGGAGGGCGAGTGTGGGCGG - Intergenic
1018195867 6:161355930-161355952 ACTGAGATGGAAAGGGAGGAGGG + Intronic
1018312230 6:162522908-162522930 GCTGGAATGGTCAGGGTTGAAGG - Intronic
1018656274 6:166040301-166040323 GCTGTGATGGAAAAGGTGGATGG - Intergenic
1018844703 6:167547495-167547517 GATGGGGTGAAGAGGGAGGAGGG - Intergenic
1019103537 6:169650596-169650618 GCATGGATGGAGGGGATGGAGGG - Intronic
1019122124 6:169811926-169811948 AGTGGGTTGGAGAGGGAGGAAGG - Intergenic
1019160624 6:170065626-170065648 GCATGGAGGGATAGGGTGGATGG - Intergenic
1019372676 7:671146-671168 GGTGGGTTGGGGAGGGTGGGTGG - Intronic
1019396688 7:823783-823805 GCGGGAATGGAGAGGGGGCATGG + Intronic
1019525112 7:1477294-1477316 GTGGGGATGGGGTGGGTGGATGG - Intronic
1019576393 7:1739677-1739699 GCTGGAGTGGAGAGGGCGGCAGG + Intronic
1019594199 7:1850853-1850875 CCTGGGATGGGGAGTGGGGAGGG + Intronic
1019633038 7:2059634-2059656 GCGGGGCTGGAGAGGGAGCATGG + Intronic
1019830286 7:3321714-3321736 GATGGGAGGGAGAGGGGAGAGGG - Intronic
1020080064 7:5282326-5282348 GGAGGGAGGGAGAGGGAGGAGGG + Intronic
1020359788 7:7315809-7315831 GCTGTGATGGACAGGATGCATGG + Intergenic
1021506010 7:21385946-21385968 TCTGGGCTGGAAAGGGTTGATGG + Intergenic
1021762410 7:23914238-23914260 GGTGGGAGGGAGCGGGTGGGAGG + Intergenic
1022057326 7:26751882-26751904 GGTGGGAGGGAGGGGGAGGATGG + Intronic
1022404480 7:30074819-30074841 GCTGGGAAGAAGAGGGTGGTGGG - Intronic
1022502666 7:30892458-30892480 GCTGGTATGGAGAATGTGGTAGG + Intergenic
1022640569 7:32178625-32178647 GATGAGATGGAGTGGGTTGAAGG - Intronic
1023095347 7:36654607-36654629 GCAGGGATGGAGAGGATGGATGG - Intronic
1023098236 7:36685380-36685402 GATGGGATGGAGCATGTGGATGG + Intronic
1023181360 7:37487000-37487022 CCTGGGATGGACATGGTGGGTGG - Intergenic
1023340796 7:39217322-39217344 GCTGGCAGGGAGTGGGTGGGTGG + Intronic
1023624404 7:42101827-42101849 GTGGGGTGGGAGAGGGTGGAGGG - Intronic
1023689315 7:42769949-42769971 GCTTGGAAGGAGAAGGTAGAGGG - Intergenic
1023829359 7:44029815-44029837 ACGGGGAGGGAGAAGGTGGAAGG - Intergenic
1023912028 7:44563099-44563121 GCTGAGATGGGAAGGGTGGGAGG - Intergenic
1023926489 7:44673623-44673645 GATGGGATGGAGTGGGTGCCAGG - Intronic
1024953628 7:54892345-54892367 CCTGGGATGGAGGAGATGGAGGG - Intergenic
1025033476 7:55575576-55575598 GCAGGGTTGGGAAGGGTGGAGGG + Intergenic
1025170936 7:56755923-56755945 GTTTGAATAGAGAGGGTGGAAGG + Intergenic
1025198856 7:56949890-56949912 GGAGGGAGGGAGAGGGAGGAGGG - Intergenic
1025673090 7:63627043-63627065 GGAGGGAGGGAGAGGGAGGAGGG + Intergenic
1026303551 7:69120163-69120185 TCTGGGAAGCAGAGGTTGGAGGG + Intergenic
1026306860 7:69150023-69150045 GGAGGGTTGGAGAGGGAGGAGGG - Intergenic
1026443752 7:70465876-70465898 GCTGGGGGAGACAGGGTGGAGGG + Intronic
1026482015 7:70787501-70787523 GCTGGGACAGGGAGGGTGGGCGG - Intronic
1026760932 7:73125181-73125203 GCGTGGATGGAGAGAGAGGAGGG - Intergenic
1026935179 7:74250638-74250660 GCCGGGATGGAGAGAAGGGATGG - Intronic
1027037274 7:74933977-74933999 GCGTGGATGGAGAGAGAGGAGGG - Intergenic
1027086288 7:75267475-75267497 GCGTGGATGGAGAGAGAGGAGGG + Intergenic
1027429514 7:78095680-78095702 GGTGGGATGGAGAGAAGGGATGG + Intronic
1028189955 7:87835707-87835729 GCGGGGAAGGAGAGGGAGGCGGG + Exonic
1028642955 7:93064192-93064214 GCTGGAAAGGATAGGGTGGAGGG - Intergenic
1028682420 7:93551685-93551707 TCCTGGATGGAGAGGATGGAAGG + Intronic
1028984150 7:96996892-96996914 TCTGGGATGGGGAGGGAGGCAGG - Intergenic
1029205572 7:98867632-98867654 GCTGGGACTGGGAGGGGGGATGG + Intronic
1029392591 7:100285502-100285524 GCGTGGATGGAGAGAGAGGAGGG + Intergenic
1029570321 7:101364034-101364056 GCGGGGTTGGAGAGGGCGCAGGG + Intronic
1029625642 7:101718751-101718773 GGTGGAACGGGGAGGGTGGATGG - Intergenic
1029739665 7:102484073-102484095 ACGGGGAGGGAGAAGGTGGAAGG - Intronic
1029757666 7:102583252-102583274 ACGGGGAGGGAGAAGGTGGAAGG - Intronic
1029775602 7:102682313-102682335 ACGGGGAGGGAGAAGGTGGAAGG - Intergenic
1029869942 7:103680198-103680220 GGTGAGAAGGAGAGGGAGGAGGG + Intronic
1029967604 7:104756059-104756081 GTTGGGATGGGGAGTGGGGATGG + Intronic
1030172410 7:106616542-106616564 GTAGGTATGGAGAGGGTGGGAGG + Intergenic
1030219983 7:107088377-107088399 CCTGGGAAGTACAGGGTGGAGGG + Intronic
1030308726 7:108047307-108047329 GCAGGGGTGGAGGAGGTGGAAGG - Intronic
1030651028 7:112116162-112116184 GCTGGGGAGAGGAGGGTGGAGGG - Intronic
1032022935 7:128420067-128420089 GCTGGGATGAGGAGGGGTGAGGG - Intergenic
1033116788 7:138632574-138632596 TGGGGGATGGAGAAGGTGGAGGG + Intronic
1033243373 7:139699481-139699503 GCTGGGTTGGAGGCTGTGGATGG - Intronic
1033606006 7:142928993-142929015 GCTGGGATGGGGAGGGGAGCTGG - Intronic
1033911827 7:146273049-146273071 TGTGGGATGGTGAGGGTGGAAGG + Intronic
1034082524 7:148292800-148292822 GTTGGGGTGGAGGGGATGGATGG - Intronic
1034087038 7:148330547-148330569 GCACGGATGGATAGAGTGGATGG + Intronic
1034087142 7:148331050-148331072 GATGGGATGGATGGAGTGGATGG + Intronic
1034190229 7:149208010-149208032 GCTGGGGTGGAAAGGGTGGAAGG + Intronic
1034279947 7:149846286-149846308 GCTTGGCTGGAGAGGGAGCATGG + Intronic
1034851562 7:154498792-154498814 GCTGGCATTGAGTGGGTAGAGGG - Intronic
1034989221 7:155537246-155537268 CCTCGGAAGGAGAGGCTGGAAGG - Intergenic
1035093691 7:156334747-156334769 GCTGGGTTGAAGTGGGTGGGCGG - Intergenic
1035540711 8:435000-435022 ATTGGGATGGAGAGGGCTGAAGG - Intronic
1035692683 8:1570619-1570641 GCTGGGATGGAGAGGAGAGAAGG + Intronic
1035692743 8:1570904-1570926 TCTGGGATGGAGAGGAGAGAGGG + Intronic
1035692794 8:1571151-1571173 TCTGGGATGGAGAGGAGAGAGGG + Intronic
1035692804 8:1571192-1571214 GATGAGATGGAGAGGGGAGAGGG + Intronic
1035692879 8:1571562-1571584 GATGAGATGGAGAGGGGAGAGGG + Intronic
1035692909 8:1571688-1571710 TCTGGGATGGAGAGGAGAGAGGG + Intronic
1035692945 8:1571851-1571873 GCTGGGATGGAGAGGAGACAGGG + Intronic
1035692963 8:1571933-1571955 GCTGGGATGGAGAGGAGAGAGGG + Intronic
1035693004 8:1572138-1572160 TCTGGGATGGAGAGGAGAGAGGG + Intronic
1035693046 8:1572343-1572365 TCTGGGATGGAGAGGAGAGAGGG + Intronic
1035693076 8:1572506-1572528 TCTGGGATGGAGAGGAGAGAGGG + Intronic
1035693103 8:1572627-1572649 GATGGGATGGAGAGGAGAGAGGG + Intronic
1035693113 8:1572668-1572690 TCTGGGATGGAGAGGAGAGAGGG + Intronic
1035693180 8:1573000-1573022 TCTGGGATGGAGAGGAGAGAGGG + Intronic
1035693229 8:1573249-1573271 TCTGGGATGGAGAGGAGAGAGGG + Intronic
1035700764 8:1638037-1638059 GCCTGGAGGGAGAGGCTGGAAGG + Intronic
1035759073 8:2055956-2055978 CCTGGGAAGGAGGCGGTGGAGGG - Intronic
1035834498 8:2734033-2734055 GCTGGGTATGAGAGGGAGGAAGG - Intergenic
1036037269 8:5032575-5032597 GAAGGAAGGGAGAGGGTGGAGGG + Intergenic
1036456408 8:8912881-8912903 GCTGGGATGGAGTGACTGGGGGG - Intergenic
1036603509 8:10285644-10285666 GCGGGGAAGGAGTGGGGGGAAGG - Intronic
1037529041 8:19756733-19756755 GCTGGGATGGAGAGGGTGGAGGG - Intronic
1037656173 8:20886042-20886064 GGAGGGAAGGAGAGGGAGGAGGG + Intergenic
1037764782 8:21765907-21765929 GGTGAGATGGAGAGGATGCATGG - Intronic
1037930694 8:22878360-22878382 GCTCTGCGGGAGAGGGTGGAGGG + Intronic
1038251683 8:25911042-25911064 TGGTGGATGGAGAGGGTGGAGGG - Intronic
1038414173 8:27381336-27381358 GCTGGGAAGGGCAGGGTGGAAGG - Intronic
1039113160 8:34062546-34062568 GTTGGTATGGATAGGGTGAAAGG + Intergenic
1039279593 8:35969503-35969525 GCTGGGAAGGGTAGGGTGAAGGG + Intergenic
1039410414 8:37350178-37350200 GCTGGGATGCAGAGAGAGGTGGG - Intergenic
1039561028 8:38512642-38512664 GAGGGGATGGAGAGGGAGGCAGG + Intronic
1039958211 8:42223400-42223422 GCAGGGATGGGGAGGGGAGAGGG + Intergenic
1039964601 8:42274790-42274812 GCTGGGATGGCGGGGGGGGGGGG - Intronic
1040915450 8:52563806-52563828 GAGGGGATGGAGAAGGTGGGAGG - Intronic
1041170862 8:55141125-55141147 GCTGGGAAGGCGTGGGTGGGAGG - Intronic
1042332939 8:67600358-67600380 GGTGGGTTGGGGTGGGTGGATGG + Intronic
1042700839 8:71612394-71612416 GCTGGGAGGGACACGGTGGGAGG + Intergenic
1043671316 8:82888175-82888197 GCTGGGATGGAGGGAAAGGAAGG + Intergenic
1044405949 8:91826257-91826279 GTTAGGAGGGAGAGGATGGAGGG - Intergenic
1044515089 8:93128264-93128286 ACTGGGATGGAAATGGTGGCCGG + Intergenic
1046817125 8:118597113-118597135 GCAAGGCTGGAGAGGGTGGCAGG + Intronic
1046872605 8:119220436-119220458 ACTGGGGAGGAAAGGGTGGATGG - Intronic
1047416204 8:124666697-124666719 CATGGGATAGGGAGGGTGGAGGG + Intronic
1047499890 8:125432347-125432369 GATGGGATGGGGTGGGAGGAGGG + Intronic
1047628285 8:126678819-126678841 GCTGGCAAGCAGAGGCTGGACGG - Intergenic
1047746998 8:127852748-127852770 GTGTGGATGGAGAGGGAGGAGGG - Intergenic
1047833341 8:128660016-128660038 GCAGGGATGGAGGGGATTGAGGG - Intergenic
1048170839 8:132104708-132104730 GCAGGGATGGTGAGGGAGGCAGG + Intronic
1048838960 8:138547841-138547863 GCTTGGCTGGAGAGGGAGGAAGG + Intergenic
1049199783 8:141334427-141334449 GCTGGGACAGAGAGGGACGAGGG - Intergenic
1049336897 8:142091442-142091464 TCTGGGATGGAGACGGGAGATGG + Intergenic
1049352469 8:142171538-142171560 GCTGTGAAGGAGAGTGGGGAGGG - Intergenic
1049376324 8:142291049-142291071 CCTGGGCAGGAGAGGTTGGAGGG - Intronic
1049408137 8:142460733-142460755 TCTGGCCTGGAGAGGGAGGAGGG - Intronic
1049580491 8:143408508-143408530 GCTGGGATGGAGACCGGGGCTGG + Intergenic
1049614262 8:143569289-143569311 CCTGGGAGGGAGAGACTGGAAGG + Intronic
1049614294 8:143569364-143569386 CCTGGGAGGGAGAGACTGGAAGG + Intronic
1049636739 8:143693011-143693033 GCTGGCGTGGACAGGGTGAAAGG + Intronic
1050095371 9:2059414-2059436 CCTGGTATGGAGAGGGAGGCAGG - Intronic
1050123261 9:2330328-2330350 GGTGAGATGGAGGGGGTGGAGGG - Intergenic
1050570023 9:6928162-6928184 GCAAGGATGGAGAGGGTGAGGGG - Intronic
1051817912 9:21131482-21131504 GCTAGGATGGAGAGTATGGAGGG + Intergenic
1052323420 9:27192656-27192678 GCTGGGTGGGAGGGGGAGGAAGG + Intronic
1052903814 9:33817280-33817302 GCGGGGCAGGAGAGGGTGGGGGG - Intergenic
1053157781 9:35792259-35792281 GCTGGGATGCAGAAGGTGCTGGG - Exonic
1053219101 9:36296671-36296693 GAAGGGAAGCAGAGGGTGGAAGG + Intronic
1053309380 9:37006694-37006716 GCTGGAATCAGGAGGGTGGAAGG + Intronic
1053413230 9:37929030-37929052 GCAGGGCTGGAGAGGGGGGTGGG + Intronic
1053647107 9:40130084-40130106 GCTGAGATGGAAAGGGTTCAGGG + Intergenic
1053758617 9:41333759-41333781 GCTGAGATGGAAAGGGTTCAGGG - Intergenic
1054537472 9:66246086-66246108 GCTGAGATGGAAAGGGTTCAGGG - Intergenic
1054797585 9:69316942-69316964 GCTGGGATGGGGAGGGTGAGTGG - Intergenic
1055091630 9:72369304-72369326 GCTGGGAACGAAAGGGAGGAAGG - Intergenic
1055194558 9:73572804-73572826 AGTGGGAAGGAGAGAGTGGAGGG + Intergenic
1055288810 9:74761009-74761031 GCTGGGAAGTCCAGGGTGGAGGG - Intronic
1055481451 9:76712476-76712498 GCTAGGATGGGGAGGGTGGGTGG + Intronic
1056722255 9:89082262-89082284 GCTGGGAGGGAGCGGGTGTGTGG - Intronic
1056735022 9:89201994-89202016 TTGGGGTTGGAGAGGGTGGATGG - Intergenic
1059748269 9:117223991-117224013 GCTGGGGGGTAGTGGGTGGAAGG - Intronic
1060230689 9:121822985-121823007 TCTGGAATGGAGACGGTGGTGGG - Intronic
1060404091 9:123364556-123364578 GTGGGGATGGGGAGGGAGGAGGG + Intronic
1060495743 9:124117621-124117643 CTTGGAATGGAGAGGGTGGCTGG + Intergenic
1060553698 9:124497734-124497756 GCAGGGCTGGAGAGGTTGGCAGG - Intronic
1060720915 9:125976787-125976809 GGAGGGAAGGAGAGGGAGGAAGG - Intergenic
1060755985 9:126214107-126214129 GCTGGGAAAGTGGGGGTGGAAGG - Intergenic
1060799450 9:126534452-126534474 GCGGGGATGGAGCGGGAGAAGGG + Intergenic
1060807695 9:126587973-126587995 GCTGGGATGGGGGCGGGGGATGG + Intergenic
1061028901 9:128068089-128068111 GCTCGGATGGGGAGGAGGGAGGG - Intronic
1061376295 9:130226637-130226659 GCTGGGAGGAGGAGGCTGGAAGG + Intronic
1061402920 9:130378285-130378307 GCTGGGAGGGAGAGGCTGGGAGG + Intronic
1061402942 9:130378355-130378377 GCTGGGATGAGGAGGCTGGTAGG + Intronic
1061402951 9:130378377-130378399 GCTGGGATGGGGAGGCTGGGAGG + Intronic
1061402975 9:130378427-130378449 GCCGGGAGGGGGAGGGTGGAAGG + Intronic
1061551026 9:131334819-131334841 GGTGGGAGGGAGAGGGTGCCTGG + Intergenic
1061623309 9:131825341-131825363 GCTGGCCTGGAGAGTGTGGGTGG - Intergenic
1061628309 9:131855559-131855581 GCTGGGAAGGAGAGTGGGGGAGG + Intergenic
1061818373 9:133209101-133209123 GCTGGGTTGGCGTGGGCGGATGG - Intronic
1061895173 9:133643355-133643377 GCTGGGGAGGGGAGGGTGGGCGG + Intronic
1061931243 9:133834230-133834252 GGAGGGATGGAGAGGAGGGAGGG - Intronic
1062109873 9:134776455-134776477 ACTTGGAAGCAGAGGGTGGAAGG + Intronic
1062171859 9:135139150-135139172 TCTGGGAAGGACAGTGTGGAGGG - Intergenic
1062178868 9:135179964-135179986 GCTGGGATGGGGCAGGTGGCTGG - Intergenic
1062242078 9:135546257-135546279 GCTGGGTTGGCGTGGGCGGATGG + Intronic
1062303608 9:135889585-135889607 GCTGGTGAGGAGAGGCTGGAGGG + Intronic
1062369760 9:136231887-136231909 GAGGGGGTGGAGAGGGTGGAGGG - Intronic
1062371448 9:136241247-136241269 GGGAGGATGGAGAGGGTGGAAGG - Intronic
1062416746 9:136455029-136455051 GGTGAGATGGAGAGTCTGGAGGG + Intronic
1062433332 9:136535501-136535523 GCAGGGTGGGAGTGGGTGGAGGG + Intronic
1062433409 9:136535711-136535733 GCAGGGTGGGAGTGGGTGGAGGG + Intronic
1062433467 9:136535872-136535894 GCAGGGTGGGAGTGGGTGGAGGG + Intronic
1203377274 Un_KI270442v1:385647-385669 GCTGGGCTGGAGCAGGGGGATGG + Intergenic
1203546654 Un_KI270743v1:133260-133282 TCTGGGGTGGAGAGGGTTGGAGG - Intergenic
1185513015 X:677207-677229 GCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1185550843 X:981353-981375 GCTGGGATGGAGGAGGAAGAGGG + Intergenic
1185950916 X:4432906-4432928 GCTAGTGAGGAGAGGGTGGACGG + Intergenic
1186367267 X:8908870-8908892 GCAGGGATGGACAGGATGGAAGG + Intergenic
1186465275 X:9779910-9779932 GAGGGCTTGGAGAGGGTGGAGGG - Intronic
1186731507 X:12415375-12415397 ACTGGGGAGGAGAGGATGGATGG - Intronic
1187031311 X:15491287-15491309 GCTGAGCTGTAGAGGATGGAGGG + Exonic
1187206389 X:17185685-17185707 GTTGGAATGGAGAGAGGGGAGGG + Intergenic
1187247247 X:17563784-17563806 TATGTGATGGAGTGGGTGGACGG + Intronic
1187622950 X:21078898-21078920 GCTGGGCTGGAGATGGTGGTGGG + Intergenic
1187775685 X:22754054-22754076 GCTGGGATGGAAAAGGTAAATGG + Intergenic
1187841166 X:23490059-23490081 GCTGGGAAGGGGAGGGGGGAGGG + Intergenic
1188737048 X:33729901-33729923 AATGGGATGGAGAGTGGGGATGG - Intergenic
1188917299 X:35927571-35927593 GGTGTGATGGACAGGGTTGAAGG + Intronic
1189230255 X:39446511-39446533 ACTGAGATGGAGAGGATGAACGG - Intergenic
1189303388 X:39969218-39969240 GCAGGGATGGTTAGGGTTGAAGG - Intergenic
1189502511 X:41576429-41576451 GCTGTGTTGGAGAGGCAGGAAGG - Intronic
1189763263 X:44343792-44343814 GCGGGGATGAAGCGGGTGGAGGG - Intergenic
1190485112 X:50916303-50916325 GCTGATTTGGAAAGGGTGGAGGG - Exonic
1190805382 X:53831008-53831030 GCTGGAAAGGGGAGGGAGGAAGG - Intergenic
1191762105 X:64657068-64657090 GGTGGTATGGAGAGGGAGAATGG - Intergenic
1191841548 X:65516849-65516871 CCTTGTATGGACAGGGTGGAAGG - Intronic
1192133535 X:68575304-68575326 GCTGAGATGGGGAGGGCAGAGGG + Intergenic
1192291708 X:69803809-69803831 GCTGGGAAGGGGAGGGGGAAGGG - Intronic
1193333318 X:80259661-80259683 GCTGGGGTGGTGGGGGAGGAAGG + Intergenic
1194960476 X:100229535-100229557 GCTGGGAAGGCAAGGGGGGAGGG - Intergenic
1196474093 X:116062254-116062276 TCTGGGATGGTTAGGGTGGAGGG - Intergenic
1196711116 X:118764181-118764203 GCTGGGAAGGTGGGGGTGGGGGG - Intronic
1197076246 X:122356682-122356704 GCTGGGAAGGGTAGTGTGGAGGG + Intergenic
1197723218 X:129759070-129759092 GCTGGGATGGGATGGGTGGACGG - Intronic
1198255093 X:134917380-134917402 GCTGGGAAGGGGAGGGGAGAAGG + Intergenic
1198321417 X:135521644-135521666 GCTGAGATGGAAAGGAGGGAGGG + Intronic
1198728274 X:139700254-139700276 GCTTGGATGGAAAAGGAGGAAGG - Intronic
1198742836 X:139859195-139859217 GCTGGGAAGGATAGGCAGGAGGG + Intronic
1198777368 X:140194488-140194510 GCTGGTCTGATGAGGGTGGATGG + Intergenic
1199979245 X:152911858-152911880 GATGGGATGGATGGGATGGATGG - Intergenic
1199979285 X:152911992-152912014 GGTGGGATGGATGGGATGGATGG - Intergenic
1200093392 X:153646338-153646360 GCTGGGCAGGGCAGGGTGGAGGG + Intronic
1200115105 X:153766477-153766499 GCAGGGATGGAGAGAGGGCAGGG - Intronic
1200167367 X:154046117-154046139 GCAGGGAAGGAGAGTGTGAAGGG + Intronic
1200908551 Y:8510998-8511020 GGAGGGAAGGAGAGGATGGAAGG - Intergenic
1201489346 Y:14524369-14524391 GATGGGATGGTGCGGGAGGAAGG - Intronic