ID: 1037537324

View in Genome Browser
Species Human (GRCh38)
Location 8:19836811-19836833
Sequence GTTTTTTTAATAGCAAAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037537323_1037537324 13 Left 1037537323 8:19836775-19836797 CCTCAGTACTTAATGCTTGGTTA 0: 1
1: 0
2: 0
3: 4
4: 115
Right 1037537324 8:19836811-19836833 GTTTTTTTAATAGCAAAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037537324 Original CRISPR GTTTTTTTAATAGCAAAGAA TGG Intronic
No off target data available for this crispr