ID: 1037539611

View in Genome Browser
Species Human (GRCh38)
Location 8:19858245-19858267
Sequence TGTCACATGGGGCAGCCATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037539604_1037539611 20 Left 1037539604 8:19858202-19858224 CCTGTGGCTCCTTGGCTGATCAA No data
Right 1037539611 8:19858245-19858267 TGTCACATGGGGCAGCCATCTGG No data
1037539602_1037539611 26 Left 1037539602 8:19858196-19858218 CCCAGGCCTGTGGCTCCTTGGCT No data
Right 1037539611 8:19858245-19858267 TGTCACATGGGGCAGCCATCTGG No data
1037539603_1037539611 25 Left 1037539603 8:19858197-19858219 CCAGGCCTGTGGCTCCTTGGCTG No data
Right 1037539611 8:19858245-19858267 TGTCACATGGGGCAGCCATCTGG No data
1037539600_1037539611 30 Left 1037539600 8:19858192-19858214 CCTGCCCAGGCCTGTGGCTCCTT No data
Right 1037539611 8:19858245-19858267 TGTCACATGGGGCAGCCATCTGG No data
1037539605_1037539611 11 Left 1037539605 8:19858211-19858233 CCTTGGCTGATCAAGTTCTGCTG No data
Right 1037539611 8:19858245-19858267 TGTCACATGGGGCAGCCATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037539611 Original CRISPR TGTCACATGGGGCAGCCATC TGG Intergenic
No off target data available for this crispr