ID: 1037542885

View in Genome Browser
Species Human (GRCh38)
Location 8:19889274-19889296
Sequence ATGTGTAAGGGGAAAGGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037542880_1037542885 1 Left 1037542880 8:19889250-19889272 CCTTTACAAACATGTGGAGTAGA No data
Right 1037542885 8:19889274-19889296 ATGTGTAAGGGGAAAGGAGAAGG No data
1037542878_1037542885 14 Left 1037542878 8:19889237-19889259 CCACACACTCAGACCTTTACAAA No data
Right 1037542885 8:19889274-19889296 ATGTGTAAGGGGAAAGGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037542885 Original CRISPR ATGTGTAAGGGGAAAGGAGA AGG Intergenic
No off target data available for this crispr