ID: 1037545534

View in Genome Browser
Species Human (GRCh38)
Location 8:19916489-19916511
Sequence GAGCCGTTGTAAGACAGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037545529_1037545534 4 Left 1037545529 8:19916462-19916484 CCTTTCCATGTTTAGTGCTTCCT 0: 4523
1: 4061
2: 1998
3: 833
4: 631
Right 1037545534 8:19916489-19916511 GAGCCGTTGTAAGACAGGCCTGG No data
1037545528_1037545534 13 Left 1037545528 8:19916453-19916475 CCAGTTGTTCCTTTCCATGTTTA 0: 3944
1: 1849
2: 1027
3: 545
4: 546
Right 1037545534 8:19916489-19916511 GAGCCGTTGTAAGACAGGCCTGG No data
1037545530_1037545534 -1 Left 1037545530 8:19916467-19916489 CCATGTTTAGTGCTTCCTTCAGG 0: 4668
1: 4230
2: 2042
3: 858
4: 703
Right 1037545534 8:19916489-19916511 GAGCCGTTGTAAGACAGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037545534 Original CRISPR GAGCCGTTGTAAGACAGGCC TGG Intronic
No off target data available for this crispr