ID: 1037547613

View in Genome Browser
Species Human (GRCh38)
Location 8:19939676-19939698
Sequence CCCGGAGTGGGATCCAGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 199}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037547598_1037547613 7 Left 1037547598 8:19939646-19939668 CCCAGCCTGGGCTCTAGCCCCGA 0: 1
1: 1
2: 0
3: 10
4: 227
Right 1037547613 8:19939676-19939698 CCCGGAGTGGGATCCAGGAGGGG 0: 1
1: 0
2: 2
3: 30
4: 199
1037547599_1037547613 6 Left 1037547599 8:19939647-19939669 CCAGCCTGGGCTCTAGCCCCGAA 0: 1
1: 0
2: 1
3: 9
4: 183
Right 1037547613 8:19939676-19939698 CCCGGAGTGGGATCCAGGAGGGG 0: 1
1: 0
2: 2
3: 30
4: 199
1037547600_1037547613 2 Left 1037547600 8:19939651-19939673 CCTGGGCTCTAGCCCCGAAACGG 0: 1
1: 0
2: 0
3: 2
4: 59
Right 1037547613 8:19939676-19939698 CCCGGAGTGGGATCCAGGAGGGG 0: 1
1: 0
2: 2
3: 30
4: 199
1037547597_1037547613 18 Left 1037547597 8:19939635-19939657 CCAGGGACTCTCCCAGCCTGGGC 0: 1
1: 0
2: 3
3: 47
4: 470
Right 1037547613 8:19939676-19939698 CCCGGAGTGGGATCCAGGAGGGG 0: 1
1: 0
2: 2
3: 30
4: 199
1037547595_1037547613 19 Left 1037547595 8:19939634-19939656 CCCAGGGACTCTCCCAGCCTGGG 0: 1
1: 0
2: 3
3: 41
4: 434
Right 1037547613 8:19939676-19939698 CCCGGAGTGGGATCCAGGAGGGG 0: 1
1: 0
2: 2
3: 30
4: 199
1037547603_1037547613 -10 Left 1037547603 8:19939663-19939685 CCCCGAAACGGTCCCCGGAGTGG 0: 1
1: 0
2: 1
3: 12
4: 491
Right 1037547613 8:19939676-19939698 CCCGGAGTGGGATCCAGGAGGGG 0: 1
1: 0
2: 2
3: 30
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037547613 Original CRISPR CCCGGAGTGGGATCCAGGAG GGG Intronic
900743086 1:4342414-4342436 CCTGGAGTGGGAATCAGGAGGGG + Intergenic
901403646 1:9031802-9031824 ACTGGAGTGGGTGCCAGGAGTGG + Intergenic
902535809 1:17118863-17118885 CTGGGAGTGGGAAGCAGGAGAGG + Intronic
902917715 1:19648593-19648615 CCCGGAGTGGGAGCTACGGGTGG + Intronic
903180366 1:21602168-21602190 CCCTGAGAGGGCTCCAGGACGGG - Intronic
905617048 1:39408733-39408755 CCCGGAGAGGGCGCAAGGAGAGG - Intronic
906588481 1:47001584-47001606 CCTGGAGTGGGAGGCAGGTGGGG - Intergenic
906654503 1:47537763-47537785 CCAGGAGTGGGACCGAGGTGAGG + Intergenic
907556518 1:55348993-55349015 CCTGGAGTTGGACCCAAGAGAGG + Intergenic
908340488 1:63173504-63173526 CCTGGAGTGAGATTCTGGAGGGG - Intergenic
911950962 1:104172752-104172774 CCTGGTGTGGGATCCACTAGGGG + Intergenic
912392253 1:109311552-109311574 CCCGGGGTGGAAACCAGGATGGG + Exonic
912722688 1:112033246-112033268 CCCAGACTGAGATGCAGGAGGGG - Intergenic
913703646 1:121397321-121397343 CCCGGGCTGGGCTCCAGGAGCGG + Intergenic
913979997 1:143499032-143499054 CCCGGGCTGGGCTCCAGGAGCGG + Intergenic
914074347 1:144324516-144324538 CCCGGGCTGGGCTCCAGGAGCGG + Intergenic
914104829 1:144641930-144641952 CCCGGGCTGGGCTCCAGGAGCGG - Intergenic
915581322 1:156814891-156814913 CTGGGAGTGGGAGCCTGGAGTGG + Intronic
915718518 1:157966340-157966362 CCCAGAGAGTGATCCAGCAGTGG - Intergenic
917188519 1:172388668-172388690 CCCAGAGTGGGGGCCAGGAGAGG - Exonic
918356470 1:183709905-183709927 CCAGGAGTGGGAACCAGGAATGG - Intronic
920564948 1:206965775-206965797 CCCGGAGATGGGTCCTGGAGGGG + Exonic
920949187 1:210556602-210556624 CCCAGAGTGGCCTCCAAGAGGGG + Intronic
922730435 1:227946532-227946554 CCCACAGTTGGAGCCAGGAGAGG + Intronic
1062868859 10:881043-881065 CCCTGAGTGGGCTTCAGGAGGGG + Intronic
1062983264 10:1743601-1743623 GCCTGACTGGGATCCAGGTGAGG + Intergenic
1065796465 10:29312714-29312736 CCCGCCATGGGAGCCAGGAGGGG - Intronic
1066064192 10:31750453-31750475 CCCGGAGTGGGGTTCAGTGGGGG - Intergenic
1068474343 10:57506775-57506797 CCTGGAGTGGGTGCCAGGAGTGG - Intergenic
1071813552 10:89208397-89208419 CCCGGAGTGGATTCAAGGACCGG - Intergenic
1073875986 10:107921445-107921467 TCTGGAGTGTGATCCAGCAGGGG - Intergenic
1074301906 10:112240726-112240748 TCTGGAGTGGGAGCCAGGAGTGG + Intergenic
1075784025 10:125036289-125036311 CCTGGAGTGGGACCCTGGAGAGG + Intronic
1076032102 10:127168179-127168201 TCCAGAGTGAGATTCAGGAGAGG - Intronic
1076618182 10:131770726-131770748 CCCGGAGGGGAAGCCAGCAGAGG + Intergenic
1077184817 11:1231299-1231321 CCGGGAGTGAGACCCAGGAGTGG - Intronic
1077300780 11:1846045-1846067 CCAGGAGTGGGGTCCCAGAGGGG + Intergenic
1077432402 11:2522312-2522334 CTCGGAGTGGGAAGCAGGACAGG - Intronic
1077545889 11:3169637-3169659 ACCCCTGTGGGATCCAGGAGCGG - Intergenic
1077639362 11:3867526-3867548 CCAGGAGTGGGAACCATGAAAGG - Intronic
1077677796 11:4212417-4212439 CCCTGACTGGGATGCAGGACTGG - Intergenic
1083404300 11:62446080-62446102 CCCAGGGAGGGATGCAGGAGGGG + Intronic
1083478339 11:62928014-62928036 CCCACAGTGGGAGCCAGAAGAGG - Intergenic
1083744705 11:64728957-64728979 CCCAGAGTGTGAGCCTGGAGGGG - Exonic
1083915992 11:65744150-65744172 CCCAGAGCGGGTGCCAGGAGTGG - Intergenic
1084163490 11:67364095-67364117 CAGGGAGTGGGAGCCAGGGGTGG + Intronic
1085082481 11:73646320-73646342 CCCGGAGTGGAATCGGGGCGAGG - Exonic
1085496784 11:76977891-76977913 CCTGGAGTGGGAGCTGGGAGCGG - Intronic
1085659791 11:78353148-78353170 CTGGGAATGGGAGCCAGGAGTGG + Intronic
1088276535 11:108092657-108092679 CCAGGAGTTGGGGCCAGGAGGGG + Intronic
1090977942 11:131691964-131691986 CCCGCAGTCCCATCCAGGAGGGG - Intronic
1091313844 11:134596815-134596837 CCCAGAATGGGAACCAGGAATGG + Intergenic
1091768786 12:3138350-3138372 CCCGGAGTCGGTTAGAGGAGGGG + Intronic
1092036447 12:5339404-5339426 TCAGGGGTGGGATCCAAGAGGGG + Intergenic
1094323162 12:29207402-29207424 CCCTGAGTAGTAGCCAGGAGGGG + Intronic
1097195187 12:57239125-57239147 CGCGGATTGGGATCCTGGTGCGG - Intronic
1099049320 12:77763964-77763986 CGAGGCCTGGGATCCAGGAGAGG + Intergenic
1100434654 12:94560715-94560737 CCTGGAGTGGTATGAAGGAGGGG + Intergenic
1101856530 12:108448156-108448178 CAAGGAGTGGGAGGCAGGAGAGG - Intergenic
1103825589 12:123735572-123735594 AGCGGAGGGAGATCCAGGAGGGG + Exonic
1104466772 12:128996808-128996830 CCGGGAGTGGGATGCAGGAGGGG + Intergenic
1108991061 13:56659046-56659068 CCCAGTGTGGGATCCACTAGGGG - Intergenic
1110795805 13:79636341-79636363 CCAGGAGTTGTATCAAGGAGGGG - Intergenic
1112904575 13:104401063-104401085 CCTGCAGTGGGATCCTGCAGTGG - Intergenic
1113910627 13:113839646-113839668 CCCGGAGTGGGAGTGAGGAGCGG + Intronic
1114712753 14:24795010-24795032 CACGGAGTGGCATACATGAGGGG - Intergenic
1115752883 14:36508283-36508305 GCCGGTGTGGTCTCCAGGAGGGG + Intronic
1116902178 14:50371859-50371881 ATCGGAGTGGGCACCAGGAGTGG - Intronic
1119038925 14:71254721-71254743 CCCGGTGTGGGATCCACTGGGGG + Intergenic
1119971905 14:78980178-78980200 CCAGGAGTGGGGACCAGGTGAGG - Intronic
1120914759 14:89701549-89701571 CCCGGAGTGGGAGCTAGGCAGGG + Intergenic
1121169503 14:91841665-91841687 GCTGGAGTGGTACCCAGGAGGGG - Intronic
1122491165 14:102116987-102117009 ATCGGAGTGGGTGCCAGGAGTGG - Intronic
1122625808 14:103084872-103084894 CCTGGGATGGGATCCAGAAGAGG + Intergenic
1122809503 14:104281063-104281085 CACGGCCTGGGATCCAGGACAGG - Intergenic
1122857660 14:104567538-104567560 CCTGAGGTGGGAACCAGGAGAGG + Intronic
1123393323 15:19899572-19899594 CCCGGGCTGGGCTCCAGGAGCGG + Intergenic
1125037951 15:35149011-35149033 CCCTGAGCAGGATTCAGGAGGGG - Intergenic
1125721381 15:41846764-41846786 TCCCGAGTGGGCTGCAGGAGGGG - Exonic
1127982779 15:64046561-64046583 TCCGGAGGGGGCTCCAGCAGGGG - Intronic
1128124765 15:65184643-65184665 CCCGTTGGGGGCTCCAGGAGGGG - Intronic
1131568385 15:93506730-93506752 ACTGGAGTGGGCACCAGGAGCGG + Intergenic
1132382790 15:101378505-101378527 CCCCGTGTGGGCTCCTGGAGAGG + Intronic
1133464597 16:6018267-6018289 TCCAGAGTGGGACCCAGGAAGGG + Intergenic
1133868202 16:9663682-9663704 CCTGTAGTGGTACCCAGGAGGGG + Intergenic
1135348731 16:21711145-21711167 CCCTGAGTGGGATCAACGTGTGG + Intronic
1135544042 16:23354004-23354026 CTTGGATGGGGATCCAGGAGGGG + Intronic
1136144970 16:28311141-28311163 CCAGGAAAGGGATGCAGGAGAGG + Intronic
1136550748 16:30981086-30981108 GCCGGAGCCGGATCCACGAGTGG + Exonic
1136699318 16:32116946-32116968 CCCGGGCTGGGCTCCAGGAGTGG + Intergenic
1136799809 16:33060117-33060139 CCCGGGCTGGGCTCCAGGAGTGG + Intergenic
1136957715 16:34804130-34804152 CCCGGGCTGGGCTCCAGTAGCGG + Intergenic
1141271061 16:82541648-82541670 GCCTGAGTGGGTGCCAGGAGGGG - Intergenic
1142222359 16:88861742-88861764 CCCGGAGTTGGTTCCAGCACTGG + Exonic
1142605779 17:1080302-1080324 CCTGGCTTGGGATCCAGGAGGGG - Intronic
1144254932 17:13458414-13458436 CCAGGAGAGAGGTCCAGGAGTGG - Intergenic
1144334263 17:14255123-14255145 GCTGGAGTGGGATCCAGGTAAGG - Intergenic
1147039702 17:37709007-37709029 CCCAGAGTGGGGGCCAGGATGGG - Intronic
1147562994 17:41520357-41520379 CCTGGGTGGGGATCCAGGAGGGG - Exonic
1147673738 17:42191273-42191295 TCAGGCCTGGGATCCAGGAGGGG - Intronic
1148755773 17:49972258-49972280 ACCGCAGCGCGATCCAGGAGTGG + Intronic
1150005718 17:61467743-61467765 CCTGGAGCTGGATCCCGGAGTGG - Intronic
1151563396 17:74883124-74883146 CCCGGAGCAGCAGCCAGGAGGGG + Intronic
1153608085 18:6854870-6854892 ACTGGAGTGGGAGCCAGGAGCGG - Intronic
1154518245 18:15197506-15197528 CCCAGGCTGGGCTCCAGGAGTGG - Intergenic
1156172013 18:34496591-34496613 CCAGGTGTGGGGTGCAGGAGTGG + Intronic
1157716805 18:49893670-49893692 CCAGAGGTGGGATCCAGGTGTGG - Intronic
1158139552 18:54242093-54242115 ACCGGAGTGGGAGCCAACAGTGG + Intergenic
1159810333 18:73011726-73011748 CTGGGAGCCGGATCCAGGAGGGG + Intergenic
1161499701 19:4607131-4607153 CCCGGAGAGGGAACAAGGCGTGG - Intergenic
1162013319 19:7830686-7830708 CCCTGAGGGGGTTCCCGGAGAGG - Intronic
1163635007 19:18433634-18433656 CCGGGGGTGGGATCCGGGGGGGG + Intronic
1163875028 19:19860820-19860842 CCCGGAGAGGGCTCCAGGCCAGG + Intergenic
1164315873 19:24087545-24087567 CCCAGAGAGGGCTCCAGGACAGG - Intronic
1167498250 19:49831433-49831455 CCTGGAGCGGGGTCCTGGAGTGG + Exonic
1167743738 19:51339448-51339470 CTCGGAGTGCAATCCAGGAGGGG - Intronic
1202680146 1_KI270712v1_random:2439-2461 CCCGGGCTGGGCTCCAGGAGCGG - Intergenic
927509737 2:23636950-23636972 GCCGGAGTGTGATTCAGGAGGGG + Intronic
927851763 2:26504001-26504023 CCCAAATTGGGAGCCAGGAGGGG + Intronic
927904543 2:26847709-26847731 CCTGGGGTGGGATCCAGCTGGGG + Intergenic
928823607 2:35392122-35392144 ACCGGAGTGGGGACCATGAGAGG + Intergenic
929664593 2:43823776-43823798 CCCAGAGAGGGAACCTGGAGAGG + Intronic
931681358 2:64751756-64751778 CCCGGAGCGGTCTCCAAGAGTGG - Intergenic
931765368 2:65451405-65451427 GTGGGAGTGGGAGCCAGGAGAGG + Intergenic
932837498 2:75051061-75051083 CCAGGAATGGGAGCCCGGAGTGG - Intronic
933848689 2:86348472-86348494 TCTGGAGTGGGCTCCAGGAGAGG - Intergenic
935667482 2:105525321-105525343 ACTGGAGTGGGCACCAGGAGTGG - Intergenic
939837612 2:147150068-147150090 CCCGGAGTGAGTGCCAGGAGTGG - Intergenic
941404740 2:165074528-165074550 CCTGGAGTGGGCACCAGGAGTGG - Intergenic
944971488 2:204998168-204998190 CATGGGGTGGGATCTAGGAGAGG + Intronic
946014881 2:216595826-216595848 CCTGGATTGGGATAGAGGAGAGG - Intergenic
947054874 2:226088367-226088389 CCTGGAGTGGGCACCTGGAGTGG + Intergenic
948056794 2:235014629-235014651 CAAGGAGTGGAAGCCAGGAGCGG - Intronic
948867112 2:240781781-240781803 ACCCGAGTGGGAGCCAGGCGAGG - Intronic
1169285281 20:4302345-4302367 CCCAGCCTGGGGTCCAGGAGGGG + Intergenic
1170305304 20:14931474-14931496 CCCTGAGAAGAATCCAGGAGTGG - Intronic
1170736116 20:19015417-19015439 CCTGGTGTGGGGTCCAGCAGAGG + Intergenic
1171218529 20:23372438-23372460 CTGGCAGTGGGATCCTGGAGAGG + Exonic
1172618242 20:36304019-36304041 CCCTGAGTGGGAACAAGGATGGG - Intergenic
1172772393 20:37389258-37389280 CCCAGAGTCAGACCCAGGAGGGG - Intronic
1173306322 20:41853871-41853893 AGCAGAGTGAGATCCAGGAGTGG + Intergenic
1174048537 20:47750991-47751013 CCAGGAGGGGAAGCCAGGAGGGG - Intronic
1174286835 20:49480078-49480100 CCCAGACTGGGATCATGGAGAGG + Intronic
1176213186 20:63935495-63935517 CCCGGTGTGAAATCGAGGAGGGG + Exonic
1176254759 20:64146188-64146210 CCCAGGATGGGACCCAGGAGGGG - Intergenic
1177139451 21:17342499-17342521 CCAGGAGTGGGGTCCAGAACAGG - Intergenic
1179003301 21:37483993-37484015 CCCGGGTTGGGAACCAGTAGAGG - Intronic
1182900797 22:33896706-33896728 CCAGGGGTGGGAGCCGGGAGTGG - Intronic
1183352612 22:37342562-37342584 GCAGCAGTGGGACCCAGGAGTGG - Intergenic
1183665797 22:39245062-39245084 CCCGGAGTCAGCGCCAGGAGGGG + Intergenic
1184766630 22:46575924-46575946 CCTGGAGGGGGATCAAAGAGAGG + Intergenic
1184776817 22:46627479-46627501 CCCTGGGTGGGAGCCAGGTGGGG + Intronic
1185102056 22:48845819-48845841 CCTGGAGTCCGATCCAGGTGAGG + Intronic
951192089 3:19782997-19783019 CCCGGAGTGTGATAGTGGAGAGG - Intergenic
951481134 3:23163615-23163637 GCGGGAGAGGGAACCAGGAGTGG - Intergenic
952605478 3:35142244-35142266 CCAGGAGTGGGGTCCAGAACAGG - Intergenic
953002578 3:38949205-38949227 CTCGCAGTGTGATCCAGCAGAGG - Intronic
953404564 3:42654156-42654178 CACGGAGGGGGAGCCAGGATAGG - Intronic
953669989 3:44954183-44954205 CACAGAGTGGGATTCAAGAGGGG + Intronic
954812621 3:53257304-53257326 CCCAGAGTGGGATTAGGGAGGGG + Intergenic
955404646 3:58618479-58618501 CCCAGAGTGGGAGCCCAGAGAGG + Intronic
959476692 3:106821075-106821097 ACCAGAGTGGGTTCCAGGAGTGG - Intergenic
959778440 3:110199476-110199498 GCAGGAGTGGGATCCTGGTGAGG - Intergenic
961337164 3:126187462-126187484 CCCGAGGTGGGATGCAGGAGAGG + Intronic
968731503 4:2271388-2271410 CCCGGAGTGGGTGCCAGACGAGG - Exonic
968816096 4:2822760-2822782 CCCAGAGTGGGCTCCTGGGGAGG + Intronic
969289542 4:6229904-6229926 CGCTGTGTGGGATGCAGGAGTGG + Intergenic
969408047 4:7007913-7007935 CTCTCAGAGGGATCCAGGAGAGG + Intronic
969573430 4:8023274-8023296 TCCTGGGTGGGATCCTGGAGCGG - Intronic
971424539 4:26503047-26503069 TCCGCAGTGGGATCCAGGGCAGG - Intergenic
974686896 4:65242442-65242464 ACCAGAGTGGGCGCCAGGAGTGG + Intergenic
975498235 4:75057636-75057658 CCCGGAATGGGCACCAGGAGAGG - Intergenic
978248646 4:106604639-106604661 ACTGGAGTGGGTTCCATGAGTGG + Intergenic
980972351 4:139578590-139578612 CACAGAGTGGGTTACAGGAGAGG + Intronic
984851521 4:184157299-184157321 GCTGCAGTGGGATCCAGCAGTGG - Intronic
989252008 5:39328117-39328139 CTTGGAGTGGGATCCAGGCTAGG + Intronic
991584098 5:68185372-68185394 CCCTGGATGGGATCCTGGAGTGG + Intergenic
994451503 5:99950305-99950327 ACTGGAGTGGGCGCCAGGAGTGG - Intergenic
997887106 5:137639804-137639826 CACGGAGTGGGGACCAGCAGGGG + Intronic
998152470 5:139765150-139765172 CACTGAGTGGGAACCAGGGGTGG - Intergenic
1001066020 5:168535779-168535801 CCAGGGGTGGGAACCAGGAGTGG - Intergenic
1002348326 5:178563402-178563424 CCTGGAGTGGAGTCCATGAGGGG + Intronic
1003034838 6:2633462-2633484 CCCAGAGTGGCAGCGAGGAGTGG - Intronic
1003862872 6:10337837-10337859 CCCGGTGCGGGATCCACTAGGGG + Intergenic
1004691522 6:17996360-17996382 CCAGGTGTGGGATCCTGGGGAGG - Intergenic
1006100787 6:31684882-31684904 CCTGGAATGGGATAGAGGAGAGG + Intergenic
1006302340 6:33200275-33200297 CCCGGAGCCGGAGCCAGGGGAGG - Exonic
1006408494 6:33858569-33858591 CCCGGAATGGCTTCCTGGAGGGG - Intergenic
1006496136 6:34425015-34425037 CCCGGGATGGGATCCCGGGGAGG + Intronic
1013349208 6:109290601-109290623 CCCGGAGTGGGATCAGGAACTGG - Intergenic
1013556602 6:111262690-111262712 ACCAGTGTGTGATCCAGGAGTGG - Intronic
1017609654 6:156171874-156171896 CCTGGAGTGGGGACCGGGAGGGG - Intergenic
1018655096 6:166026820-166026842 CACGGAGTGGGGAGCAGGAGAGG + Intergenic
1022536837 7:31103585-31103607 CCCAGGGTGGGGGCCAGGAGTGG - Intronic
1022654225 7:32304206-32304228 CACAGAATGGGATCCAGGGGAGG - Intergenic
1022843904 7:34191104-34191126 CCTGGAGATGGATCCAAGAGGGG + Intergenic
1023846292 7:44122668-44122690 GGAGGAGTGGGAACCAGGAGGGG - Intronic
1025481935 7:60992929-60992951 CCCGGGCTGGGATCCAGGAGCGG + Intergenic
1025562061 7:62381021-62381043 CCCGGGCTGGGCTCCAGGAGCGG + Intergenic
1025605613 7:63038133-63038155 CCCGGAGTGTGACTCAGGAATGG + Intergenic
1025788567 7:64666543-64666565 CCCGGAGAGGGCTCCAGGCCAGG - Intronic
1025840440 7:65141425-65141447 CCCGGGCTGGGCTCGAGGAGCGG + Intergenic
1025882616 7:65554539-65554561 CCCGGGCTGGGCTCGAGGAGCGG - Intergenic
1025890827 7:65648064-65648086 CCCGGGCTGGGCTCGAGGAGCGG + Intronic
1026049167 7:66930447-66930469 CCCGGAGTGGAAACTGGGAGAGG + Intronic
1029539971 7:101176949-101176971 CCAGCAGTGGGACCAAGGAGTGG + Intronic
1035163586 7:156969465-156969487 CCAGGATTGAGATCTAGGAGAGG + Intronic
1035278167 7:157760281-157760303 CCAGGAGTGTGACCCAGGATGGG + Intronic
1035568526 8:657988-658010 CCCCAAGGGGCATCCAGGAGGGG + Intronic
1035920204 8:3668230-3668252 CCCAGAATGAGATCCAGCAGTGG - Intronic
1036387051 8:8291758-8291780 CCCTGTGTAGCATCCAGGAGAGG - Intergenic
1037547613 8:19939676-19939698 CCCGGAGTGGGATCCAGGAGGGG + Intronic
1039474535 8:37832891-37832913 CTTGGGGAGGGATCCAGGAGCGG - Intronic
1040533166 8:48282503-48282525 CCAGGAGTGGGAAGCATGAGTGG - Intergenic
1041055913 8:53985730-53985752 CCGGGAAAGGGCTCCAGGAGAGG - Intronic
1048151659 8:131900868-131900890 CCCAGACTGGGCTCCAAGAGAGG + Intergenic
1049303587 8:141884836-141884858 CCCGGAGCAGGTTCCAGCAGAGG - Intergenic
1052829532 9:33203515-33203537 CCAGGAGTGGGGAGCAGGAGAGG - Intergenic
1053368415 9:37540724-37540746 CCCTGTGTGGGATCAAGGAAGGG - Intronic
1056968474 9:91183699-91183721 CCTGGGGTAGGATCCAGGTGTGG - Intergenic
1059336605 9:113572945-113572967 CCCGGAATTGGATGCAGGAGAGG + Intronic
1059558060 9:115301199-115301221 CCCAGCTTGGGATCCAGCAGCGG - Intronic
1060225289 9:121786574-121786596 CCCAGGGTGGGCCCCAGGAGTGG - Intergenic
1060402256 9:123355838-123355860 TGGGGAGGGGGATCCAGGAGAGG + Intergenic
1061195217 9:129103608-129103630 CCCATGGTGGGATCCAGGGGCGG - Intronic
1062156413 9:135051265-135051287 GCCTGCCTGGGATCCAGGAGTGG - Intergenic
1187734715 X:22292088-22292110 CTGGAAGTGGGATCCAGGCGTGG - Intergenic
1188779707 X:34266467-34266489 CCCTGAGTGGGACACTGGAGAGG + Intergenic
1190116792 X:47630465-47630487 CCTGGGGAGGGATTCAGGAGGGG + Intergenic
1190290578 X:48989550-48989572 CCAGGACTGGGAGCCTGGAGAGG - Intronic
1191861261 X:65667994-65668016 ACCGGAGTGGGATCCTGGTCTGG + Intronic
1198792146 X:140357300-140357322 CCGGGAGTGGGAATCAGGAATGG + Intergenic