ID: 1037548847

View in Genome Browser
Species Human (GRCh38)
Location 8:19950496-19950518
Sequence ATTGCTTAACTTGGAAACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037548843_1037548847 14 Left 1037548843 8:19950459-19950481 CCACTGTAGGAGTAAGTTGGATG 0: 1
1: 0
2: 0
3: 0
4: 79
Right 1037548847 8:19950496-19950518 ATTGCTTAACTTGGAAACACTGG No data
1037548844_1037548847 -10 Left 1037548844 8:19950483-19950505 CCAGCCTTTTTAGATTGCTTAAC 0: 1
1: 0
2: 0
3: 10
4: 161
Right 1037548847 8:19950496-19950518 ATTGCTTAACTTGGAAACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037548847 Original CRISPR ATTGCTTAACTTGGAAACAC TGG Intronic
No off target data available for this crispr