ID: 1037549079

View in Genome Browser
Species Human (GRCh38)
Location 8:19952151-19952173
Sequence AAATATCAAACGATAGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 184}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037549079_1037549081 16 Left 1037549079 8:19952151-19952173 CCCTGCTCTATCGTTTGATATTT 0: 1
1: 0
2: 0
3: 15
4: 184
Right 1037549081 8:19952190-19952212 TGCTGAGACCAATAACTAAGTGG No data
1037549079_1037549082 17 Left 1037549079 8:19952151-19952173 CCCTGCTCTATCGTTTGATATTT 0: 1
1: 0
2: 0
3: 15
4: 184
Right 1037549082 8:19952191-19952213 GCTGAGACCAATAACTAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037549079 Original CRISPR AAATATCAAACGATAGAGCA GGG (reversed) Intronic
901279692 1:8024691-8024713 AAATAACAAAGGATTTAGCATGG - Intronic
902895150 1:19474590-19474612 AAATATCAAACCCTGAAGCAGGG + Intronic
909770099 1:79411369-79411391 AAAGAACAAAAGATAGAGAAGGG + Intergenic
910741965 1:90529264-90529286 GAATTTCAAACAATAGGGCAGGG + Intergenic
911085296 1:93972186-93972208 AAAAATGAAAGGGTAGAGCAGGG + Intergenic
911374811 1:97039189-97039211 CAATAACAAACAATAGAGAAAGG - Intergenic
916314845 1:163437814-163437836 AAAGATCAAAAAGTAGAGCAGGG + Intergenic
917542888 1:175932781-175932803 AAATTTCAAAAGGTAGGGCAGGG + Intergenic
917834088 1:178927179-178927201 AAATCTCAAGCCCTAGAGCAGGG + Intergenic
920008447 1:202850563-202850585 AAAAATCAACCGCTATAGCAAGG + Intergenic
921299774 1:213739842-213739864 AAACATCTTACAATAGAGCACGG - Intergenic
921304825 1:213785500-213785522 AGATATAAAACAATACAGCAAGG + Intergenic
922143230 1:222911398-222911420 AAGTATAAAACTGTAGAGCAAGG + Intronic
1064417513 10:15163205-15163227 AAAAATCAAACAATAGGGCCAGG - Intronic
1066398928 10:35055683-35055705 AAATATCAAATGGTACATCAAGG - Intronic
1069312598 10:67056873-67056895 CAATATCAAGTGAGAGAGCAAGG + Intronic
1075167697 10:120084139-120084161 ACATATGAAAAGATAGAGAATGG - Intergenic
1075877049 10:125816203-125816225 AAAACTCAAACGATAAAACAGGG + Exonic
1076782054 10:132729792-132729814 AAACATCAAACTACAGAGGACGG + Intronic
1078586268 11:12592364-12592386 AAATATAGAACAACAGAGCACGG + Intergenic
1079143031 11:17826240-17826262 AAATATCAAAGGATATGGCTTGG - Intronic
1080015400 11:27501066-27501088 AAATAGCATATGATAGAGCTGGG - Intronic
1085986810 11:81797657-81797679 AAGTATCAAAAGATATATCAAGG - Intergenic
1086388389 11:86334639-86334661 AGAAATCAAACGGTAGAGTAAGG + Intronic
1087409930 11:97778986-97779008 AAAAATTAAATGATAGGGCAAGG - Intergenic
1089380776 11:118029787-118029809 AAGTATCAAAACATAGAGCCTGG - Intergenic
1092306665 12:7307920-7307942 TAATATCAAAGGATAGAATATGG + Intronic
1095643987 12:44520910-44520932 AAAAATCAATGGAAAGAGCAAGG - Intronic
1096951889 12:55481551-55481573 AAATTTCCAACAATAGAGCATGG - Intergenic
1097371866 12:58793069-58793091 AAAAAGCAAAAGACAGAGCATGG - Intronic
1098114829 12:67164047-67164069 AAATATGGAATGATAGAGCAGGG + Intergenic
1098366060 12:69704380-69704402 AAAAATCAAACCAAAGAGGATGG + Intergenic
1100219818 12:92492931-92492953 AAATATAAAATGATAGTGAAGGG + Intergenic
1101081497 12:101189993-101190015 AAATAGCAAATATTAGAGCAGGG + Intronic
1101752396 12:107593127-107593149 AAATATTTTACCATAGAGCAGGG + Intronic
1102186947 12:110956625-110956647 AAATAGGAAACTAGAGAGCATGG + Intergenic
1106842116 13:33694983-33695005 AAATGCCAAAAGATAGAGCAAGG + Intergenic
1106937153 13:34735601-34735623 AAAGAGCAAGCGATAGAGTAGGG - Intergenic
1107518770 13:41158977-41158999 AAGTATCATAGGATAGAACATGG - Intergenic
1107813380 13:44220968-44220990 AAATTTCACAGGATAGAGAAGGG + Intergenic
1107995762 13:45859370-45859392 CAATGTCAAACTATAGAACAAGG - Intergenic
1108735091 13:53275189-53275211 AAATTTCAAACTATTGAGCTTGG + Intergenic
1110727509 13:78842351-78842373 AAATATTAAGCAATACAGCAGGG - Intergenic
1111640097 13:90957776-90957798 AAATATCTACAAATAGAGCAAGG + Intergenic
1112924124 13:104652224-104652246 AAATATCTAACATGAGAGCATGG - Intergenic
1114495792 14:23131274-23131296 TAATATCAAGAGATATAGCAAGG - Intronic
1116214257 14:41990804-41990826 AAATATCCTACCATAGAGGATGG - Intergenic
1116424041 14:44767743-44767765 AAATATCAAAAGTAAGGGCAGGG + Intergenic
1118143598 14:63111964-63111986 AGATAACAAACAATATAGCAGGG - Intergenic
1119984165 14:79116808-79116830 ACATAGCAAAAGATATAGCAGGG + Intronic
1119995023 14:79244052-79244074 AATCATCAAACGATAGAGCCAGG - Intronic
1123877718 15:24640564-24640586 AAATATCAGATGAGAGAGCATGG - Intergenic
1125126800 15:36233228-36233250 ATATATGAAATGAAAGAGCATGG + Intergenic
1127623155 15:60753685-60753707 AAATATAAAGGGATATAGCATGG - Intronic
1128443798 15:67738982-67739004 AAATATCAAACATTGGAGCCAGG + Intronic
1130683937 15:86020812-86020834 AAACAACAAACGATATTGCAAGG + Intergenic
1130768787 15:86903205-86903227 AAATATCAAAAGCTAGATAAAGG - Intronic
1137909838 16:52366115-52366137 AAATATCAAGTGATAGAGGAAGG - Intergenic
1140433280 16:74923248-74923270 CAGTATTAAATGATAGAGCATGG + Intronic
1143429032 17:6865946-6865968 GGAAATCAAACGATAGAGGATGG + Intergenic
1144091203 17:11858227-11858249 AAATATCAAATAGTAGAGAAAGG + Intronic
1149123583 17:53200100-53200122 AGATATCAAACCATAGATCTAGG - Intergenic
1150166961 17:62953102-62953124 ACATTTCAAACGATTGAGAATGG - Intergenic
1154322288 18:13364635-13364657 AAAAATCAAATAATAGAGCTGGG - Intronic
1155109066 18:22696190-22696212 AAATATCAAATGATAAAGAAAGG - Intergenic
1155897043 18:31342819-31342841 AAATATTAAAGGAGAGAACAAGG - Intronic
1156312372 18:35936290-35936312 AAATATTAAACAAAAGAGAATGG + Intergenic
1157229670 18:45903202-45903224 AAATATTAAATGATATAGAAAGG - Intronic
926525604 2:13976038-13976060 AAATATATAACATTAGAGCAAGG + Intergenic
927467029 2:23345013-23345035 AAATCTCAAACAATTTAGCAGGG - Intergenic
928996856 2:37302172-37302194 AAATAACTAATGATACAGCATGG + Intronic
929205424 2:39286407-39286429 AAATTTCTAACTATAGATCAGGG - Intronic
929582794 2:43093820-43093842 AAATGTCAAAGGATAGGCCAGGG - Intergenic
930457161 2:51619756-51619778 AAATATGAAAGGATAGATGAAGG - Intergenic
931527714 2:63175823-63175845 AAATGTCAATAGATAGAGAATGG - Intronic
933307256 2:80617456-80617478 AAATAATAAATGATACAGCAAGG + Intronic
936334375 2:111576190-111576212 CAATATCCAAGGAGAGAGCAAGG - Intergenic
937502229 2:122491669-122491691 AAATCTAAAAAGAGAGAGCATGG - Intergenic
937570615 2:123354682-123354704 AGATATCAAACCATAGATCTAGG - Intergenic
939729567 2:145765276-145765298 AAATAGCAAACAACAGAACAAGG - Intergenic
941267454 2:163380214-163380236 ACATATCAAAACATAGAACAGGG + Intergenic
942570516 2:177309625-177309647 AAATATCAAAGGAGAGAGCGGGG + Intronic
942705549 2:178767694-178767716 AAATATAAAATGATAGATTATGG + Intronic
944777769 2:202985379-202985401 AAATATAAATCTAAAGAGCAGGG - Exonic
945265486 2:207887396-207887418 AAATATCACACCACAGAGAAAGG + Intronic
945637991 2:212383122-212383144 AAATATCAAACTATAGAAAAAGG - Intronic
948260318 2:236599552-236599574 TAATGTCAAACAATAGAGCAAGG - Intergenic
1174122479 20:48276714-48276736 AAATAGCAAACAATAGTGCCAGG + Intergenic
1174967446 20:55233743-55233765 AAATATAAAAAGATACAGCCGGG - Intergenic
1177031791 21:15989350-15989372 AAATATCAAAAGATTAAGAATGG - Intergenic
1177916123 21:27090016-27090038 CAATATAAAACAACAGAGCAAGG - Intergenic
1178689582 21:34740077-34740099 AAATATGAAATGACAAAGCATGG + Intergenic
1182871734 22:33653624-33653646 AAATAACAAAATACAGAGCATGG + Intronic
950238430 3:11344942-11344964 AAATATACAAAGATAGAACAAGG - Intronic
951375895 3:21916729-21916751 AAATATCAAACAATAAGGAATGG - Intronic
952540008 3:34357806-34357828 AATTATCAAAGCACAGAGCAGGG + Intergenic
953250479 3:41242151-41242173 AAATATCCACAGATGGAGCAAGG + Intronic
955942527 3:64159721-64159743 AAATAGAAAAAGATACAGCAAGG - Intronic
956912542 3:73833979-73834001 AAATATCAATTGATAGAAGATGG + Intergenic
960541651 3:118868550-118868572 AAATCTCAAATGATAGGGAAAGG - Intergenic
962143325 3:132813515-132813537 AAATATCCTACAATGGAGCATGG - Intergenic
964192067 3:154014767-154014789 AAATAGTAAAGGATAGAACAAGG + Intergenic
964885871 3:161481721-161481743 AACTATCAAAACATAGAGAAAGG - Intergenic
966672226 3:182540039-182540061 AAATATCAAAATGTAGGGCATGG + Intergenic
966843708 3:184109836-184109858 AAATATCAAAAGGTACAGTATGG + Intergenic
967054460 3:185817284-185817306 AACTATCAAATGATGGAACAGGG + Intronic
967095993 3:186177697-186177719 AGATAACACACGATAGAGCCTGG - Intronic
970755029 4:19415385-19415407 GAATATCAAACCATTGAGGATGG + Intergenic
971229352 4:24787434-24787456 ACATATCAAGCTATAGAGGATGG - Intergenic
974799660 4:66800873-66800895 AAATAGTAAACTAAAGAGCATGG - Intergenic
974831820 4:67199020-67199042 AATTATGAAATGATACAGCAGGG - Intergenic
977822785 4:101494637-101494659 AAACAGCAAACTTTAGAGCAAGG + Intronic
981606752 4:146547611-146547633 AAACAACAAACCATAGAGAATGG - Intergenic
981963766 4:150576534-150576556 AAATATACAATGATAGAGTAAGG - Intronic
982306944 4:153942462-153942484 AAATCTCAAACAATAGGCCATGG - Intergenic
982360271 4:154512038-154512060 AAATAACAAACTAGAAAGCAAGG + Intergenic
982641578 4:157968564-157968586 AAATATGAGATGACAGAGCAGGG - Intergenic
986573085 5:9185221-9185243 AAATCTCAAAAAATAGAGCTGGG - Intronic
986573206 5:9186570-9186592 AGTTATCAACTGATAGAGCATGG - Intronic
986630192 5:9764723-9764745 ATATATCAAACAAGAGAACATGG + Intergenic
987729513 5:21750644-21750666 ACATATCAAATAATAGAGGATGG - Intergenic
988767550 5:34396989-34397011 AAAGAGCAAGCGAGAGAGCAGGG - Intergenic
993213300 5:84983522-84983544 AAATAGAAAACGATATATCAGGG + Intergenic
993636275 5:90347763-90347785 AAATATGAAACCATATAGCCAGG + Intergenic
995314777 5:110756478-110756500 AAAAATCAAATGATAAAACAAGG - Intronic
997000586 5:129754532-129754554 AAAAATAAAACGATACATCATGG - Intronic
997886610 5:137635988-137636010 GAATATCAAACAATAGAGTAGGG - Intronic
997998949 5:138609014-138609036 AAATAAGATATGATAGAGCAGGG - Intergenic
1002048696 5:176556819-176556841 AAATATCAAATGATACTACAAGG + Intronic
1002791957 6:443637-443659 AAATATCAAAGAACACAGCAAGG + Intergenic
1004763883 6:18702170-18702192 AAAAATGAAAAGAAAGAGCAGGG - Intergenic
1005217073 6:23542894-23542916 AAATATCAAACTACAGGTCAAGG - Intergenic
1006199827 6:32278443-32278465 AAAAATCAAACCACAAAGCAAGG + Intergenic
1008401762 6:51071441-51071463 AAAGAAGAAATGATAGAGCAAGG - Intergenic
1010446765 6:75957663-75957685 AAATATCAAAAGCCAAAGCAGGG - Intronic
1011212974 6:84974121-84974143 AAAAATCAAACGCCAAAGCAGGG + Intergenic
1011570918 6:88733561-88733583 AAATATCAAACTACAGATCCAGG + Intronic
1012179114 6:96128827-96128849 AAATATCAAACTAAAGGGCCAGG + Intronic
1012432612 6:99181532-99181554 AGATATCAAACCATAGAGGCAGG - Intergenic
1012603902 6:101133100-101133122 AAGTATCTGAAGATAGAGCATGG - Intergenic
1013069086 6:106712084-106712106 AAATTACAAACTATAAAGCAAGG - Intergenic
1014385085 6:120790825-120790847 AATTATCAAAATATAAAGCAAGG + Intergenic
1015199509 6:130563563-130563585 AAAAATCAAAAGAGACAGCATGG + Intergenic
1015483671 6:133744051-133744073 AAATATCAATGTATAGAGCTGGG + Intergenic
1016214082 6:141574242-141574264 AAATAGAAAACTATAAAGCATGG - Intergenic
1017116506 6:150982303-150982325 AAATATCAAGTTATAGAGCAGGG - Intronic
1018134234 6:160764100-160764122 AAATATCAATCAATAGACGAGGG + Intergenic
1018331675 6:162734714-162734736 ACTTATTAAAGGATAGAGCAAGG + Intronic
1020955783 7:14739152-14739174 TAATATCTAACGATAGAGGCAGG + Intronic
1021186792 7:17574288-17574310 AAAAATCAAAAGACAGAGAAAGG + Intergenic
1021428717 7:20534967-20534989 GTATATGAAACAATAGAGCATGG - Intergenic
1021854071 7:24836441-24836463 AAATATAAAACAAGAGAGTATGG - Intronic
1022463059 7:30630212-30630234 AAATATCACAAGATGGAGGAAGG + Intronic
1022904616 7:34843754-34843776 AAATTTCAAACGTGAGAGCTGGG + Intronic
1022939652 7:35221312-35221334 AAATATCAAAAGAAAAAGAAAGG + Intronic
1028098439 7:86790901-86790923 AAAAAACAAAAGGTAGAGCAGGG - Intronic
1028384329 7:90237429-90237451 AAATATCTAATGAAAGATCAAGG - Exonic
1028442124 7:90875678-90875700 AAATATCTAAAAATAGAGAAAGG - Intronic
1028517862 7:91698282-91698304 CAAAATCAAACTATAGGGCAGGG + Intronic
1030783070 7:113625495-113625517 AAAGATCAAATGATAAAGGAGGG + Intergenic
1031521096 7:122766837-122766859 AACTAGCAAATGATAGAGCTGGG - Intronic
1032059283 7:128710519-128710541 AAATATCATACAATAAAGCTGGG - Intronic
1032759258 7:134923692-134923714 TTATATCAAACGATAGCACAGGG - Intronic
1033955025 7:146836471-146836493 AAATAGCAAACCCTAGATCAAGG - Intronic
1034732295 7:153398583-153398605 GAATATTAAAAGATAAAGCATGG + Intergenic
1034854730 7:154532392-154532414 AAATATCAAACCAAAGACCTAGG + Intronic
1036576310 8:10030817-10030839 AAATATTAAATCATACAGCAGGG - Intergenic
1036959670 8:13230421-13230443 AAAAAGCAAACGATAAAGCAAGG + Intronic
1037549079 8:19952151-19952173 AAATATCAAACGATAGAGCAGGG - Intronic
1038421479 8:27436771-27436793 AAAAATCCAATGATAGAGAAAGG + Intronic
1039731631 8:40285759-40285781 AAATAAGAAACGACTGAGCAAGG + Intergenic
1039813185 8:41068293-41068315 AAATATCAAACAATAGAAAGTGG + Intergenic
1041046956 8:53896366-53896388 AAACATCAAACAAATGAGCATGG - Intronic
1041289143 8:56292161-56292183 GAATATCAAAAGATAAAGTAAGG - Intergenic
1041782050 8:61587694-61587716 ATATATGAAAAGATAGAACATGG - Intronic
1041875993 8:62687755-62687777 AAAGATCAAAAAAGAGAGCAGGG - Intronic
1043835817 8:85044450-85044472 AAATGTCAAACATTAAAGCAAGG - Intergenic
1044251937 8:90013077-90013099 AAAAATCAAACTCTTGAGCATGG - Intronic
1044398168 8:91738518-91738540 AGATAGTAAACGACAGAGCAGGG + Intergenic
1044849652 8:96416176-96416198 AAATATCCATCAATAGAGAAAGG + Intergenic
1046098139 8:109584439-109584461 AAGTATCAAACAATATAGAAAGG - Intronic
1046158670 8:110330366-110330388 AAATATCAAGTGCTAGAGCTTGG - Intergenic
1047703482 8:127473516-127473538 AAATACCGAAGGAGAGAGCAAGG - Intergenic
1050181776 9:2930870-2930892 AAATATCTAACCATAGCGTAAGG - Intergenic
1053392368 9:37745036-37745058 AAAGAACCAACCATAGAGCATGG + Exonic
1055760733 9:79604668-79604690 AAAGACCAAAAAATAGAGCATGG + Intronic
1056112996 9:83414824-83414846 AAATATCAAAACATACAACAAGG - Intronic
1057804030 9:98208132-98208154 ACAAATCAAAGGAGAGAGCAGGG + Intronic
1058138290 9:101331678-101331700 ACATATAAAAAGAAAGAGCAAGG + Intergenic
1058916402 9:109570303-109570325 AAATGGAAAACGAAAGAGCAGGG + Intergenic
1059743992 9:117182457-117182479 AGATATTAAACCCTAGAGCATGG + Intronic
1188994353 X:36864449-36864471 ATATATGAAAAGACAGAGCAGGG + Intergenic
1191015528 X:55806021-55806043 AAAAATAAAAAGAAAGAGCAAGG - Intergenic
1192421201 X:71033126-71033148 AAATAATAAATGATAGAGCAAGG - Intergenic
1193502953 X:82302562-82302584 CAATAACAAACAATAGAGAAAGG + Intergenic
1194256138 X:91636813-91636835 AAATAGGAAAAGATAGAGCATGG + Intergenic
1196119566 X:112035281-112035303 AAATAGCAAACCCTAGAGAAAGG - Intronic
1199427134 X:147715990-147716012 AAAAATCAAACGGGAGAGAATGG + Intergenic
1199573724 X:149292750-149292772 AAATTTCAAACCATATAGCGGGG + Intergenic
1200736625 Y:6805761-6805783 AAATATCAAAAGAAAGAAAAAGG + Intergenic