ID: 1037556102

View in Genome Browser
Species Human (GRCh38)
Location 8:20024075-20024097
Sequence CTCATAAGATACCCTGAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037556101_1037556102 0 Left 1037556101 8:20024052-20024074 CCAGCTGACGTCTTGACTACAGT No data
Right 1037556102 8:20024075-20024097 CTCATAAGATACCCTGAGCCAGG No data
1037556100_1037556102 1 Left 1037556100 8:20024051-20024073 CCCAGCTGACGTCTTGACTACAG No data
Right 1037556102 8:20024075-20024097 CTCATAAGATACCCTGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037556102 Original CRISPR CTCATAAGATACCCTGAGCC AGG Intergenic
No off target data available for this crispr