ID: 1037556726

View in Genome Browser
Species Human (GRCh38)
Location 8:20032187-20032209
Sequence TGGTGGTTATGAGGGTGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037556726_1037556731 9 Left 1037556726 8:20032187-20032209 CCATGTCACCCTCATAACCACCA No data
Right 1037556731 8:20032219-20032241 CTCTACTTCTATGACCCAACAGG No data
1037556726_1037556732 21 Left 1037556726 8:20032187-20032209 CCATGTCACCCTCATAACCACCA No data
Right 1037556732 8:20032231-20032253 GACCCAACAGGCATATGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037556726 Original CRISPR TGGTGGTTATGAGGGTGACA TGG (reversed) Intergenic
No off target data available for this crispr