ID: 1037560211

View in Genome Browser
Species Human (GRCh38)
Location 8:20066685-20066707
Sequence GTACATTCACATGCTGTTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037560211_1037560214 11 Left 1037560211 8:20066685-20066707 CCTGTAACAGCATGTGAATGTAC No data
Right 1037560214 8:20066719-20066741 GGCAATTATAACACAACGGTAGG No data
1037560211_1037560213 7 Left 1037560211 8:20066685-20066707 CCTGTAACAGCATGTGAATGTAC No data
Right 1037560213 8:20066715-20066737 TGTAGGCAATTATAACACAACGG No data
1037560211_1037560212 -10 Left 1037560211 8:20066685-20066707 CCTGTAACAGCATGTGAATGTAC No data
Right 1037560212 8:20066698-20066720 GTGAATGTACTAAATATTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037560211 Original CRISPR GTACATTCACATGCTGTTAC AGG (reversed) Intergenic