ID: 1037563118

View in Genome Browser
Species Human (GRCh38)
Location 8:20092549-20092571
Sequence GGTCAGAGAGGAGAACAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037563118_1037563127 21 Left 1037563118 8:20092549-20092571 CCCTCTTGTTCTCCTCTCTGACC No data
Right 1037563127 8:20092593-20092615 TCTGCTCTACTCCATCCTCGGGG No data
1037563118_1037563125 19 Left 1037563118 8:20092549-20092571 CCCTCTTGTTCTCCTCTCTGACC No data
Right 1037563125 8:20092591-20092613 TATCTGCTCTACTCCATCCTCGG No data
1037563118_1037563121 -5 Left 1037563118 8:20092549-20092571 CCCTCTTGTTCTCCTCTCTGACC No data
Right 1037563121 8:20092567-20092589 TGACCAAATGTTTTTTTCCCTGG No data
1037563118_1037563126 20 Left 1037563118 8:20092549-20092571 CCCTCTTGTTCTCCTCTCTGACC No data
Right 1037563126 8:20092592-20092614 ATCTGCTCTACTCCATCCTCGGG No data
1037563118_1037563128 28 Left 1037563118 8:20092549-20092571 CCCTCTTGTTCTCCTCTCTGACC No data
Right 1037563128 8:20092600-20092622 TACTCCATCCTCGGGGATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037563118 Original CRISPR GGTCAGAGAGGAGAACAAGA GGG (reversed) Intergenic
No off target data available for this crispr