ID: 1037563613

View in Genome Browser
Species Human (GRCh38)
Location 8:20097389-20097411
Sequence CTGAATAAGAAGAATAAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037563613_1037563616 -2 Left 1037563613 8:20097389-20097411 CCCTCCTTATTCTTCTTATTCAG No data
Right 1037563616 8:20097410-20097432 AGAAGCATCTCAAATATTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037563613 Original CRISPR CTGAATAAGAAGAATAAGGA GGG (reversed) Intergenic
No off target data available for this crispr