ID: 1037564350

View in Genome Browser
Species Human (GRCh38)
Location 8:20104979-20105001
Sequence GGAAGCAACATGTATCAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037564350_1037564354 7 Left 1037564350 8:20104979-20105001 CCTGACTGATACATGTTGCTTCC No data
Right 1037564354 8:20105009-20105031 GCATCTTATTGCAGGGATTGAGG No data
1037564350_1037564353 0 Left 1037564350 8:20104979-20105001 CCTGACTGATACATGTTGCTTCC No data
Right 1037564353 8:20105002-20105024 TTTCTGAGCATCTTATTGCAGGG No data
1037564350_1037564355 23 Left 1037564350 8:20104979-20105001 CCTGACTGATACATGTTGCTTCC No data
Right 1037564355 8:20105025-20105047 ATTGAGGCCTGAAAATTACCTGG No data
1037564350_1037564352 -1 Left 1037564350 8:20104979-20105001 CCTGACTGATACATGTTGCTTCC No data
Right 1037564352 8:20105001-20105023 CTTTCTGAGCATCTTATTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037564350 Original CRISPR GGAAGCAACATGTATCAGTC AGG (reversed) Intergenic
No off target data available for this crispr