ID: 1037564406

View in Genome Browser
Species Human (GRCh38)
Location 8:20105497-20105519
Sequence TAGGCAAGCAAACCTGACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037564400_1037564406 5 Left 1037564400 8:20105469-20105491 CCAGAGCAAGTTTTACTGTCCTC No data
Right 1037564406 8:20105497-20105519 TAGGCAAGCAAACCTGACCCTGG No data
1037564399_1037564406 25 Left 1037564399 8:20105449-20105471 CCATCAAAGCTCTGGGACATCCA No data
Right 1037564406 8:20105497-20105519 TAGGCAAGCAAACCTGACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037564406 Original CRISPR TAGGCAAGCAAACCTGACCC TGG Intergenic
No off target data available for this crispr