ID: 1037565892

View in Genome Browser
Species Human (GRCh38)
Location 8:20118216-20118238
Sequence ACTTGCTGGGGACAGTTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037565884_1037565892 26 Left 1037565884 8:20118167-20118189 CCTGAAATCAAGGACACTGCCTT No data
Right 1037565892 8:20118216-20118238 ACTTGCTGGGGACAGTTTGAAGG No data
1037565888_1037565892 7 Left 1037565888 8:20118186-20118208 CCTTATCTAATGGTGCTGGGAGT No data
Right 1037565892 8:20118216-20118238 ACTTGCTGGGGACAGTTTGAAGG No data
1037565883_1037565892 27 Left 1037565883 8:20118166-20118188 CCCTGAAATCAAGGACACTGCCT No data
Right 1037565892 8:20118216-20118238 ACTTGCTGGGGACAGTTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037565892 Original CRISPR ACTTGCTGGGGACAGTTTGA AGG Intergenic
No off target data available for this crispr