ID: 1037569724

View in Genome Browser
Species Human (GRCh38)
Location 8:20148062-20148084
Sequence CAGAGGAACCTGCATGGGGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 408
Summary {0: 1, 1: 0, 2: 6, 3: 51, 4: 350}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037569717_1037569724 3 Left 1037569717 8:20148036-20148058 CCAATGAGACCAAAAATATTGTG 0: 1
1: 0
2: 2
3: 13
4: 219
Right 1037569724 8:20148062-20148084 CAGAGGAACCTGCATGGGGAAGG 0: 1
1: 0
2: 6
3: 51
4: 350
1037569714_1037569724 21 Left 1037569714 8:20148018-20148040 CCAAGCCCTGCATTGGGGCCAAT 0: 1
1: 0
2: 0
3: 8
4: 122
Right 1037569724 8:20148062-20148084 CAGAGGAACCTGCATGGGGAAGG 0: 1
1: 0
2: 6
3: 51
4: 350
1037569718_1037569724 -6 Left 1037569718 8:20148045-20148067 CCAAAAATATTGTGAGCCAGAGG 0: 1
1: 1
2: 1
3: 13
4: 367
Right 1037569724 8:20148062-20148084 CAGAGGAACCTGCATGGGGAAGG 0: 1
1: 0
2: 6
3: 51
4: 350
1037569716_1037569724 15 Left 1037569716 8:20148024-20148046 CCTGCATTGGGGCCAATGAGACC 0: 1
1: 0
2: 0
3: 9
4: 148
Right 1037569724 8:20148062-20148084 CAGAGGAACCTGCATGGGGAAGG 0: 1
1: 0
2: 6
3: 51
4: 350
1037569715_1037569724 16 Left 1037569715 8:20148023-20148045 CCCTGCATTGGGGCCAATGAGAC 0: 1
1: 0
2: 0
3: 5
4: 102
Right 1037569724 8:20148062-20148084 CAGAGGAACCTGCATGGGGAAGG 0: 1
1: 0
2: 6
3: 51
4: 350

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037569724 Original CRISPR CAGAGGAACCTGCATGGGGA AGG Exonic
900310999 1:2033072-2033094 GAGAGGAACCTGTTTGGGGAGGG + Intergenic
900482452 1:2905688-2905710 CAGAGGACCCTCAATGGGGCGGG + Intergenic
900713137 1:4127658-4127680 GAGACGAGCCAGCATGGGGAGGG - Intergenic
900796676 1:4712336-4712358 AAGAGGCACCTGCAGGGGGACGG + Exonic
901378309 1:8855550-8855572 CAGAGTAGGCTGCCTGGGGAAGG + Intergenic
902955599 1:19922578-19922600 CAGGGGGACCTCCATGGGGATGG - Intronic
903647300 1:24903034-24903056 GAGAGGAACCTGCCTGGGCAGGG - Intronic
903967448 1:27099613-27099635 CAGGGGAAGCTGCTAGGGGAAGG - Exonic
904810617 1:33161292-33161314 CAGAGGGAGCCGCATGAGGAAGG + Intronic
907913297 1:58846101-58846123 CAGAGGAAACAGCATGGGGAAGG - Intergenic
907922898 1:58929806-58929828 CAGAGAAACCTGTCTGGAGAGGG - Intergenic
908256542 1:62308282-62308304 CACAGGCGCCTGCATGGAGAGGG + Intronic
908604672 1:65783294-65783316 CACAGCAACCTGCATGGAGTTGG + Intergenic
908702777 1:66920222-66920244 AAGAGGAATCTGGCTGGGGACGG + Intronic
909878633 1:80844701-80844723 CAGTGGGACCTGCTGGGGGAGGG - Intergenic
910773345 1:90851442-90851464 CAGAGGGCCCTGCTTGGGGCGGG - Intergenic
910870478 1:91828803-91828825 GAGAGGGACCTGCAGTGGGAGGG - Intronic
911275434 1:95853293-95853315 CAGTGGCACCTGGAAGGGGAGGG - Intergenic
914912573 1:151799648-151799670 CAGAGGAAGCTGCAGAAGGATGG + Intergenic
916060740 1:161097084-161097106 CAGAGAACACAGCATGGGGATGG - Intergenic
917234022 1:172871230-172871252 GAGAGTAACCTGCATGGGAATGG + Intergenic
918141477 1:181723797-181723819 CAGAGGGAAAGGCATGGGGATGG + Intronic
919706558 1:200681814-200681836 CAGAGAAACTTGCCTGGGGCTGG + Intergenic
919756566 1:201069730-201069752 CAGAGGACCCTGCAGGTGCAGGG - Intronic
919798163 1:201333786-201333808 CAGGGCCACCTGGATGGGGAAGG + Intergenic
919807566 1:201389350-201389372 TAGAGGAGCCTGCCTCGGGAGGG - Intronic
920942715 1:210499205-210499227 CAGAGGGACATGGATGAGGATGG - Intronic
920960949 1:210663657-210663679 TAGGGGAATCTGCAGGGGGAAGG - Intronic
921222200 1:212981171-212981193 CAGAGTCTCCTGCCTGGGGAGGG + Intronic
921311441 1:213847743-213847765 GAGAGGATCCTGGATGGGGCTGG - Intergenic
922224200 1:223631201-223631223 CAGAGAAAGCTTCATGGAGAAGG - Intronic
922655479 1:227378928-227378950 AGCAGGAACCAGCATGGGGAAGG + Intergenic
922717963 1:227886842-227886864 GGGAGGTACCTGCGTGGGGAGGG - Intergenic
923339659 1:232996498-232996520 CAGAGTAAACAGCATGGGGTGGG + Intronic
924613483 1:245592381-245592403 CAAAGGCACCTGCCTGGCGAAGG - Intronic
1063029580 10:2220239-2220261 CTGAAAATCCTGCATGGGGAGGG - Intergenic
1063385201 10:5612195-5612217 CAGTAGAAGCTGGATGGGGAAGG - Intergenic
1063850838 10:10188154-10188176 GAGAGGAAATTGCAGGGGGAAGG + Intergenic
1064051788 10:12066093-12066115 TAGGGGAACCTGCAAGTGGAAGG - Intergenic
1067148894 10:43713408-43713430 CAGAAGGTCCTGCCTGGGGATGG - Intergenic
1067350934 10:45474913-45474935 CAGAGGGAGCTGCCTGGAGATGG + Intronic
1067681927 10:48446939-48446961 TACAGGCCCCTGCATGGGGAGGG + Intronic
1067828689 10:49597624-49597646 CTGAGGACCCTGCAGGAGGATGG - Intergenic
1068253216 10:54470573-54470595 CATAGGAAGCTGCATGGGGATGG - Intronic
1069243300 10:66169322-66169344 CAGAGCAACCTGGATGGGACTGG - Intronic
1069689825 10:70343125-70343147 CAGAGAAAGCTTCATGGAGAAGG - Intronic
1069938608 10:71937581-71937603 CACTGGAACATGCAGGGGGAGGG - Intergenic
1069987326 10:72293308-72293330 AAGAGGAAGCAGAATGGGGAGGG - Intergenic
1070660838 10:78304219-78304241 AGAAGGAACCAGCATGGGGAGGG - Intergenic
1071998207 10:91167624-91167646 GAGAGAATGCTGCATGGGGAGGG + Intronic
1072564985 10:96609957-96609979 CACAGGAGCCTGCATGGGAAGGG + Intronic
1073295424 10:102435684-102435706 CAGAAGAGCCAGCATGGGGCGGG + Intergenic
1073351927 10:102825994-102826016 CAGAGGAACCGGGAGAGGGAAGG - Intergenic
1073440200 10:103547985-103548007 CACCAGAACCTGGATGGGGAGGG - Intronic
1074206968 10:111291169-111291191 CAGAGCAACCTGCAAGGTAAGGG - Intergenic
1074283642 10:112077647-112077669 CACAGCAACCTGGATGGGAATGG + Intergenic
1074462216 10:113648037-113648059 CAGAGGACTCTGCCTGGGGCAGG - Intronic
1074764559 10:116691198-116691220 CAGGGGAAGCAGCCTGGGGAAGG + Intronic
1075894912 10:125986781-125986803 CTGAGGAACAGGCATGGGGCAGG - Intronic
1076365298 10:129917947-129917969 CAGAGGACCCAGAATGGGGCAGG + Intronic
1076480573 10:130782662-130782684 CAGAGAGACCAGCAGGGGGAGGG + Intergenic
1077273670 11:1693553-1693575 CACAGGAACCTTCTGGGGGATGG + Intergenic
1077710945 11:4536334-4536356 CAGTGGTAGCTTCATGGGGATGG - Intergenic
1077827763 11:5829599-5829621 CAGAGCACCCTGCAGTGGGATGG + Intronic
1078746819 11:14123671-14123693 AGGAGGAAGCTGCATGGAGATGG - Intronic
1079394523 11:20050309-20050331 AAGAGGCAGCTGCATGGGGAGGG - Intronic
1080635619 11:34120955-34120977 CAGAGGAAGCAGCATGTGCATGG + Intronic
1082102347 11:48183135-48183157 CAGAGCAACCTGTGTGGGGAAGG + Intergenic
1082794586 11:57370045-57370067 CAGAGGACCCTGCCTGAGCAAGG + Exonic
1083190708 11:61050075-61050097 CAGAGGAAACTGGAAGGGGAAGG - Intergenic
1084085886 11:66855042-66855064 CTGAGGAACCTGCACGGGCAGGG + Intronic
1084199086 11:67543424-67543446 CTGGGGTACCAGCATGGGGAGGG + Intergenic
1084253111 11:67917888-67917910 CATAGGAACCTGGATGGAGTTGG - Intergenic
1085555292 11:77413954-77413976 AAGAGGATGCTGCATGGGGTGGG - Intronic
1086315225 11:85584273-85584295 CACAGTAACCTGGATGGGGTTGG - Intronic
1088162002 11:106883484-106883506 CATAGTAAGCTCCATGGGGACGG - Intronic
1088222124 11:107580501-107580523 CAGAGCACACTGCATGGGGGTGG + Intergenic
1089013709 11:115149774-115149796 CAGAGGCTCTTGCATGGTGAGGG - Intergenic
1089321319 11:117628568-117628590 CAGAGGAGCCGGTATGGAGATGG - Intronic
1089461260 11:118655720-118655742 CAGAGGGACAGCCATGGGGAAGG + Intronic
1089499097 11:118922402-118922424 CAGAGGAGCCGGGATGGGGCTGG - Intronic
1089561463 11:119345407-119345429 CAGAGGGACCTACCTGAGGAGGG + Exonic
1089600053 11:119608429-119608451 CACAAGAACCTGGATGGAGAAGG - Intergenic
1089721516 11:120428058-120428080 CATAGGAACCAGCTTGGGGTGGG - Exonic
1089824838 11:121265795-121265817 GGGAGGAGCCTGCATGGGGCTGG - Intergenic
1090228294 11:125084684-125084706 CAGAGAAATCTGCATAGGCAGGG + Intronic
1090390423 11:126384026-126384048 GAGAGGGCCCTGCATTGGGAAGG - Intronic
1090756108 11:129793231-129793253 TAGAAGAACCTGCCTGGGGAGGG - Intergenic
1091239691 11:134044094-134044116 CAGAGGGAGCTGCATGGGGAAGG - Intergenic
1092147181 12:6222737-6222759 CAGTGGAACCTCCAGGGGTAAGG - Intronic
1092830379 12:12438927-12438949 TAGGGGAAGCTGCATGGGGCAGG - Intronic
1092892104 12:12978673-12978695 GAGAGGTACCTGTATGTGGAGGG + Intronic
1093049957 12:14493245-14493267 CTGAAGAACAGGCATGGGGATGG - Intronic
1093479128 12:19586360-19586382 CACAGCAACCTGAATGGAGATGG + Intronic
1094701235 12:32872621-32872643 CAGGGGAACCAGCCTGGGCAGGG - Intronic
1096967177 12:55637674-55637696 CAGAGGAGCCTGCCTGCGGCCGG - Exonic
1098088545 12:66875446-66875468 CAAAGGAACTTGCATGAAGATGG - Intergenic
1101181169 12:102219599-102219621 CTGGGGAATCTGCATGGGAAAGG + Intergenic
1101290847 12:103367140-103367162 CACAGCAACCTGTATGGGAATGG + Intronic
1103744298 12:123111653-123111675 CAGAGGAGCCTGCACGGGGGTGG - Intronic
1103971484 12:124675545-124675567 CAGAGGCCCCTGCCAGGGGAAGG + Intergenic
1104648189 12:130511884-130511906 CAGAGGCAGCTGCCTGGAGAAGG - Intronic
1104846693 12:131850612-131850634 CAGAGGAGCCTGCTGGGGCAGGG - Intronic
1107120978 13:36795610-36795632 GAGAGGTACCTACTTGGGGAGGG - Intergenic
1107603377 13:42035875-42035897 CAGAGGAAAATGCATGGAGTAGG + Intergenic
1108529088 13:51312190-51312212 TAGAGGATCCTGCATTGGGCAGG - Intergenic
1108674578 13:52725099-52725121 CAGAGAAGGCTGCATGGAGAAGG - Intronic
1109001386 13:56810655-56810677 CACAGGAACCAACCTGGGGAAGG + Intergenic
1110698014 13:78514750-78514772 CATAGGTAGCTTCATGGGGATGG + Intergenic
1110728816 13:78856456-78856478 CATAGGTAGCTTCATGGGGATGG + Intergenic
1111376054 13:87380137-87380159 CAGAGTAAGCTGCACGTGGAGGG - Intergenic
1111727518 13:92031138-92031160 CACATGAACCTGAATGGGGATGG - Intronic
1112781620 13:102906932-102906954 TAGAGGAAGATGGATGGGGAAGG - Intergenic
1113582741 13:111440448-111440470 CAGGGGAAGCTGCAGGGGGCAGG - Intergenic
1113763786 13:112868247-112868269 CAGAGGGATCTGCACAGGGAGGG + Intronic
1114760637 14:25310006-25310028 CACAGGAACCTGAATGGAGTTGG + Intergenic
1115772056 14:36674357-36674379 CAGAGGACCCTGCATTGGGCAGG + Intronic
1116034061 14:39606987-39607009 CAGAGAGCACTGCATGGGGAAGG - Intergenic
1117293299 14:54354292-54354314 CATGGGAACTTGCATGGGGAGGG - Intergenic
1118840211 14:69504266-69504288 CAGAGCAGCCTGCAGAGGGAGGG + Intronic
1119319992 14:73724925-73724947 CAGAGGAAGATGCAGGGGGAGGG - Intronic
1119760729 14:77149053-77149075 CAGATGAACATGGATGGTGAGGG + Intronic
1120491001 14:85178740-85178762 CAGAGGAACTTGAATGAGTAGGG + Intergenic
1121100961 14:91249963-91249985 CACAGGAAGCTGCCTGGGGAAGG + Intronic
1121180515 14:91925438-91925460 CAGAGGAGCATGCTTGGGGAAGG - Intronic
1121414609 14:93770484-93770506 CAGAGGAAACAGCATGTGCAAGG - Intronic
1121530005 14:94645633-94645655 CAGAGAAACCTTCATGGAGGAGG - Intergenic
1121585206 14:95058595-95058617 CAGAGGAAGCTGCATGTCAAAGG + Intergenic
1121711680 14:96043293-96043315 CAGAGGCACATGCTGGGGGAAGG + Intronic
1121840565 14:97130408-97130430 CATATGAACCTGCAATGGGAAGG - Intergenic
1121954931 14:98205138-98205160 AAGAGGAACCTGCAGAAGGAAGG + Intergenic
1122179944 14:99947506-99947528 CAGAGAAGGCTGCATGTGGAAGG - Intergenic
1122299664 14:100724594-100724616 GGGAAGAACCTGGATGGGGAAGG + Intergenic
1124887606 15:33701631-33701653 CAGAGCAACCTGGAGGGGGAGGG + Intronic
1126504805 15:49392362-49392384 CAGTGGAATGTGCATGGGGAAGG + Intronic
1126504922 15:49393923-49393945 TAGTGGAATGTGCATGGGGAAGG + Intronic
1126544043 15:49853245-49853267 AAGAGTAACCTAGATGGGGAAGG + Intergenic
1126891822 15:53213795-53213817 TAGACGAACCTACTTGGGGAGGG - Intergenic
1127318029 15:57815925-57815947 CAGAGGAAGCTGCAGAGGGCAGG + Intergenic
1127873290 15:63090981-63091003 CAAAGAAACCTGGCTGGGGAGGG - Intergenic
1131140982 15:89977016-89977038 CAGCGGATGCTGCATGTGGAAGG + Intergenic
1131177449 15:90219074-90219096 TAGAGAAGCCTCCATGGGGAAGG + Intronic
1132618838 16:854980-855002 CAGAGGGACCGGCCCGGGGAAGG + Intronic
1132839953 16:1974103-1974125 CACAGGTACCAGCCTGGGGAAGG + Exonic
1133258404 16:4532971-4532993 GAGAGGAACTTGGATGGTGATGG - Intronic
1134297648 16:12961184-12961206 CAGAGGGAACTGCATGGTGCAGG + Intronic
1136049525 16:27640484-27640506 CAGAGGAGCCTCCCTGGGGCTGG + Intronic
1137620236 16:49871553-49871575 CAGAAGTACCTGTATGGGAAGGG + Intergenic
1137927517 16:52554779-52554801 CAGAGGAAACTTCATGGAGAAGG + Intergenic
1139478130 16:67213377-67213399 CAGAGGAAACTGGCTGGGGCAGG + Intronic
1139740850 16:69033837-69033859 CAGAGGGACCAGCTTGGTGATGG - Intronic
1139848938 16:69939276-69939298 CGGAGGATCCTGCTTTGGGAAGG + Intronic
1140478107 16:75249028-75249050 CAGAGGAGGTGGCATGGGGAGGG + Intronic
1141206704 16:81938507-81938529 CAGAGGCACCTGCTTGGGCATGG + Intronic
1141337992 16:83175490-83175512 CAGGAGAAACTGTATGGGGATGG + Intronic
1141767768 16:86070134-86070156 GAGAGGAAGCTGCATGAGGGCGG + Intergenic
1142106242 16:88304414-88304436 CAGAGGAATCTGCAGGGGCCAGG + Intergenic
1142132329 16:88436745-88436767 CAGAGGAGGCTGCAGGGGCAGGG + Exonic
1142674274 17:1503926-1503948 GAGAGGAACCTGGAGGGGGCCGG - Intronic
1143306632 17:5952611-5952633 AAGAGGACCCTAGATGGGGATGG + Intronic
1143434008 17:6909234-6909256 CAGAGAAAGCTGCATGGGGGAGG + Intronic
1143994687 17:10996514-10996536 CAGGGCAAGCTTCATGGGGAAGG + Intergenic
1146585807 17:34080577-34080599 GAGAGGTACCTGCAGAGGGAAGG + Intronic
1146754502 17:35416199-35416221 CACAGCAACCTGAATGGGGTGGG + Intronic
1147476578 17:40717514-40717536 CAGAGGAACCAGGCTGGTGACGG - Intergenic
1147914495 17:43878457-43878479 CAGTGGAAGCTGGATGGGCAGGG + Intronic
1147993562 17:44349634-44349656 CAGAGAAACCTGCATTGGCAGGG - Intronic
1148086706 17:44997957-44997979 CAGAGGCCCCTGCAGGGGGCAGG + Intergenic
1149364165 17:55924137-55924159 CAGAGGAAACGTCATGGGAAGGG - Intergenic
1149431588 17:56598429-56598451 CAGAGGACCCTCCATTGAGAGGG - Intergenic
1149468475 17:56897777-56897799 CAGAGGAAGGTGACTGGGGAAGG + Intronic
1149988921 17:61369591-61369613 CGGAGGGACCGGCATGGGGATGG - Intronic
1151424914 17:74024727-74024749 CAGAGAAACCTGCTGGGGGTGGG - Intergenic
1151540264 17:74761244-74761266 CAGAGGAGCCTGAATGGGGAGGG - Intronic
1151788381 17:76287863-76287885 CAGAGGATCCTGGAAGGGGAAGG - Exonic
1151974267 17:77475595-77475617 CAGGGGAGCCTGCAGAGGGAGGG + Intronic
1153052118 18:909232-909254 CAGGAGATCCTGCGTGGGGAGGG + Intronic
1153227179 18:2907824-2907846 CAGATGACCCTGAATGGGGCAGG + Intronic
1153836122 18:8965584-8965606 CAGAGAAAACTGCATGGCGAGGG - Intergenic
1154035536 18:10798182-10798204 CAGAGGAACCAGCCTAGTGATGG + Intronic
1155444520 18:25897101-25897123 CAGTGGCACCTGCACGGGGGTGG + Intergenic
1156798619 18:41080005-41080027 CACAGTAACCTGGATGGGAATGG - Intergenic
1157733090 18:50021636-50021658 CAGAAGAACCTGCAACGTGAGGG - Intronic
1157738436 18:50071166-50071188 CAGAGGAACCAGCATGAGCAAGG - Intronic
1158537490 18:58321353-58321375 CAGAGGGACCTGCCTGTGCATGG + Intronic
1158895803 18:61911760-61911782 CAGAGGAACCTGGATGGCGAAGG + Intergenic
1160922913 19:1529042-1529064 CAGAGAAGCCGGCATGGGGGAGG - Intronic
1161362012 19:3855757-3855779 CAGAGGGAATTGCATGGGAAGGG + Intronic
1161667521 19:5586184-5586206 CAGAGGATGGTGCATGGGGTTGG - Intergenic
1161792710 19:6370123-6370145 CAAAGGAACAGGCTTGGGGAGGG + Intergenic
1163101680 19:15101161-15101183 CAGAGGAACCAGCAAAGGGGTGG - Intergenic
1163115304 19:15185400-15185422 CAGCGGAACCTGGCAGGGGAAGG + Exonic
1163491929 19:17621936-17621958 CACAGGAATATTCATGGGGATGG + Intronic
1164434605 19:28218741-28218763 CAGAGGAGCGAGCATGGGAAAGG + Intergenic
1164723363 19:30448421-30448443 AAGAGAAACCTGCAAGGTGAAGG + Intronic
1165060271 19:33201724-33201746 CAGATGGACCAGCGTGGGGAAGG + Intronic
1165326230 19:35116026-35116048 GAGAGGACCTTGAATGGGGAAGG - Intronic
1166012142 19:39950397-39950419 CAGAGAAACCTGAATGCGGGGGG - Intergenic
1166536023 19:43575385-43575407 GTGAGGGACCTGCATGGGGGAGG - Intronic
1166546866 19:43639429-43639451 CAGCGGGACCGGCCTGGGGAGGG + Intronic
1167173391 19:47848827-47848849 CAGAGGAAACAGCTGGGGGAAGG - Intergenic
1167578682 19:50329691-50329713 CAGATGAGACTGCATGGGGCGGG + Intronic
1168421568 19:56207546-56207568 TTGAGGAAACTGGATGGGGATGG - Intronic
1168426820 19:56245706-56245728 TTGAGGAAACTGAATGGGGAAGG - Intronic
1202644346 1_KI270706v1_random:126702-126724 CAGAGGCACCTGCATGTGTTAGG + Intergenic
925018560 2:551170-551192 CTGAGGTCCCTGCATGGGGAAGG + Intergenic
925070931 2:965784-965806 CAGAAGGACCTGTATGGGGGTGG + Intronic
927561360 2:24076554-24076576 CAGAGGAACCCGGGTGGAGAGGG + Intronic
927640321 2:24841659-24841681 AAGAGGATGCTGCATGAGGAAGG + Exonic
928077017 2:28274155-28274177 GAGAGAAAGCTGGATGGGGAAGG - Intronic
928115433 2:28542611-28542633 GAGAGGAGCGTGCAGGGGGAGGG - Intronic
929920721 2:46169409-46169431 CAGAGGAACATGGAGGGTGAAGG - Intronic
930907018 2:56582215-56582237 CAGAGGAAACTGAATTTGGATGG + Intergenic
931222047 2:60296863-60296885 TAGAGGAACCTGAGTGGAGAAGG - Intergenic
931646245 2:64424626-64424648 CAGAGGAACTTGGGTGGGGCTGG - Intergenic
931855706 2:66299737-66299759 GAGGGGAGCCAGCATGGGGAGGG + Intergenic
932055056 2:68434936-68434958 CAGAGGAAACTGCAAGTGCACGG + Intergenic
932761758 2:74442366-74442388 CAGAGGAGCCTAGGTGGGGAGGG - Intronic
932890294 2:75589966-75589988 CTAAGGAACCCTCATGGGGAGGG - Intergenic
933216733 2:79638651-79638673 CACAGGAAACTGCATGAGGCAGG + Intronic
934742422 2:96734447-96734469 AAGAAGAATCTGCATGGGGATGG - Exonic
935566550 2:104614539-104614561 AAGAGGAAGCTGCATAGGGTTGG + Intergenic
936674528 2:114699787-114699809 CAGAGGAACCAGAAGGGGCAAGG + Intronic
938377586 2:130818967-130818989 GAGAGGAGAGTGCATGGGGAAGG + Intergenic
939062334 2:137437657-137437679 AAGAGGAACCTGATTGGTGAGGG + Intronic
939144257 2:138393906-138393928 CAGAGGAAGGTGAATGCGGAAGG - Intergenic
941230421 2:162904888-162904910 CAAGGGAACCTTCATGGTGATGG + Intergenic
941584667 2:167342684-167342706 CAGAGGAACAAGGATGGGGAGGG - Intergenic
941976204 2:171407964-171407986 CAAAAGAACCTGCATGATGATGG + Intronic
942308788 2:174634819-174634841 CAAAGGAACCTGAAGGGGGAAGG + Intronic
943621711 2:190155522-190155544 TAGAGGAAGCTGAATGGGGTGGG + Intronic
945505450 2:210634818-210634840 CTGAGGAAACTGGATGGTGAGGG - Intronic
946037320 2:216754543-216754565 CAGAGCAGCTTGAATGGGGAAGG - Intergenic
948542346 2:238699621-238699643 CACAGGCACCTGAATGGGGCTGG + Intergenic
1168836568 20:881561-881583 CAGAGGACAGGGCATGGGGAGGG + Intronic
1169899969 20:10542984-10543006 AACAGCAACCTGGATGGGGATGG - Intronic
1170515987 20:17130856-17130878 TAGAGGCACCAGCATGGTGAAGG + Intergenic
1171018379 20:21562071-21562093 GAGAGGAACCTGCCTGAGGATGG - Intergenic
1171347879 20:24479515-24479537 CAGAGGAAGGGGCATGGGAAGGG - Intronic
1171516546 20:25742898-25742920 CATAGTAACATGCATGTGGATGG - Intergenic
1171971683 20:31568921-31568943 CAGAGCAGCCTGCCTGAGGAGGG + Intronic
1171983074 20:31640510-31640532 GAGTGGGAACTGCATGGGGAAGG + Intronic
1172133771 20:32673624-32673646 CAGAGGAGCCTGCAGGTGGGTGG - Intergenic
1172216789 20:33241393-33241415 CAGAAGACCTTGAATGGGGAGGG - Exonic
1173142472 20:40496071-40496093 CAGAGGAACCAGCACTGGTAAGG - Intergenic
1173262196 20:41446560-41446582 CAGAGGCAGCTGGAGGGGGAGGG - Intronic
1173960890 20:47071797-47071819 GAGAGGAACATGCAGGAGGAGGG - Intronic
1174781640 20:53394898-53394920 CAGTGGAGGCTGCATGTGGAGGG - Intronic
1175225536 20:57441874-57441896 CAGAGGAATGGGCAGGGGGAGGG + Intergenic
1175815260 20:61880253-61880275 CAGAGGCATCTGCCTGGGGAGGG + Intronic
1175870707 20:62208246-62208268 CAGAGGATCCTGAACAGGGAAGG - Intergenic
1177505907 21:22016806-22016828 CTGAGGAACAGGCATGGGAATGG - Intergenic
1178159842 21:29899374-29899396 CAGACAAACCTGCATAGGCATGG - Intronic
1179121444 21:38549908-38549930 CAGAGGCATCTGCATGGCCAAGG - Intronic
1179486219 21:41712365-41712387 GAGGGGGACCTGCAGGGGGAGGG + Intergenic
1180671289 22:17555550-17555572 AAGAAGATCCTGCTTGGGGATGG - Intronic
1181260174 22:21591756-21591778 CAGAGGAAGCAGCCTGGCGAAGG + Intronic
1181671248 22:24426541-24426563 CAGAGGAGCCCAGATGGGGAAGG + Intronic
1182044545 22:27264100-27264122 CAGAGGAGACAGCATGTGGAAGG + Intergenic
1182098537 22:27642083-27642105 CTGAGGAATCTGCTGGGGGAGGG - Intergenic
1182270069 22:29147794-29147816 CAGGGGCACGTGCATGGGGCTGG + Intronic
1182899958 22:33889693-33889715 CGGAGGCACCTACAAGGGGATGG + Intronic
1183348909 22:37323826-37323848 CAGAGAAACCTGCAGGTGAATGG - Intergenic
1183541488 22:38431622-38431644 CAGAGGCTGCTCCATGGGGAAGG - Intronic
1183664783 22:39241072-39241094 CAGAGGAAGCTGGATGGCAAAGG + Intronic
1184203537 22:42985797-42985819 CAGTGATTCCTGCATGGGGAGGG - Intronic
1184396591 22:44245607-44245629 CGGAGGGGCCTGCCTGGGGATGG + Exonic
1184434917 22:44466232-44466254 AAGAGGAATCTGCATTGGAAAGG - Intergenic
1184587166 22:45455765-45455787 CAGAGAGCCCTGCATGGGGGCGG - Intergenic
1184723545 22:46329832-46329854 CAGAGGAATGTGCATGGTGGGGG + Intronic
1184841636 22:47055656-47055678 CAGAGCAGCCAGCATGGAGAGGG + Intronic
1184987473 22:48145544-48145566 CTGAGGCACCTGCTAGGGGATGG - Intergenic
1185151684 22:49167441-49167463 CAGAGGAACCAGCCTGGGCTAGG - Intergenic
1185176889 22:49332936-49332958 GAGAGGAGCCTACATGAGGAAGG + Intergenic
950651709 3:14411327-14411349 CTGAGGGACCAGCATGGGCAGGG - Intronic
952027513 3:29100371-29100393 CACAGGAACCGACCTGGGGAGGG - Intergenic
952304538 3:32134398-32134420 AAGAGGAACCTGCAGGTGGTAGG - Intronic
952711788 3:36439101-36439123 CAGTGGAAAGAGCATGGGGACGG + Intronic
952862148 3:37821856-37821878 CCCAGGAACCTGTCTGGGGAAGG + Exonic
953984523 3:47431121-47431143 CAGAGGCACCTGGATGGAGCTGG + Intronic
954099213 3:48356453-48356475 CAGAGGAAACTGCAAGAGGCTGG + Intergenic
954131726 3:48564483-48564505 CAGAGGCACCGCCAAGGGGAGGG + Intronic
954876812 3:53807628-53807650 CAGAGGCCCCTGCAAGGGGTAGG + Intronic
955711523 3:61784073-61784095 AAGAGGAACCTGCATAGAGAAGG + Intronic
956471060 3:69567245-69567267 CAGAGGAAGCAGCATAAGGAAGG - Intergenic
958822576 3:98992464-98992486 CAGAGGAAACTGAAGGGAGAGGG - Intergenic
958867211 3:99515396-99515418 CAGAGAAAGCTTCATGGAGAAGG - Intergenic
959496520 3:107058454-107058476 CAGGGGATCCTGCATTGGGAGGG - Intergenic
960939616 3:122924987-122925009 GACAGGCACCTGCATGGAGAAGG + Intronic
961219396 3:125187763-125187785 CAGGGGAATCAGCATGAGGAGGG - Intronic
961225118 3:125237205-125237227 CAGAGGAACCAAGATGGGAAGGG + Intronic
961520992 3:127467312-127467334 CAGAAGAAAGTGCCTGGGGATGG - Intergenic
961786609 3:129351102-129351124 CAGAGGAAACAGCATGAGCAAGG - Intergenic
962401818 3:135067217-135067239 GAGAGGCACCAGCGTGGGGAAGG + Intronic
963771750 3:149393296-149393318 CAGAGGAAGTAGCATGGGAAAGG - Intergenic
964024871 3:152060433-152060455 CAGAGTAAACTGCTTGGTGATGG - Intergenic
966918169 3:184596155-184596177 CACAGGAACCTGGATGGGGAAGG - Intronic
966937843 3:184725577-184725599 CAGGGGAAGCTGCATCAGGACGG - Intergenic
967819988 3:193831524-193831546 CAGTGAAACCTGGCTGGGGAGGG + Intergenic
968746722 4:2364276-2364298 CACAGGCACCTGCAGGGGGTAGG - Intronic
969721255 4:8894068-8894090 CAGCGGCGCCTGCACGGGGAGGG + Intergenic
970225364 4:13851709-13851731 CAGTGGAATCTCCATGGGAAAGG - Intergenic
970460585 4:16270789-16270811 GAGAGGAAGCTTCTTGGGGAAGG + Intergenic
973870950 4:55165814-55165836 CAGTGGAAGCTTGATGGGGATGG + Intergenic
974243908 4:59289195-59289217 CAGATGAACATGAATGAGGAAGG - Intergenic
978191746 4:105921946-105921968 CAGAGAAACATGCAAGGGTAGGG - Intronic
978448613 4:108804911-108804933 CTGAGGTATCTGCATGAGGATGG + Intergenic
979130674 4:117040693-117040715 CAGAGGACCCTGCAAAGAGAAGG + Intergenic
981245314 4:142530001-142530023 CATAGGAACATGCAGGGGGCAGG + Intronic
985902353 5:2806431-2806453 CAGGAGAACCTGCTTGGGCAGGG + Intergenic
986315046 5:6581641-6581663 CCGAGTTACCTGCTTGGGGAAGG - Intergenic
986528418 5:8706488-8706510 CAGAGGCAGCTTCTTGGGGAAGG + Intergenic
987169046 5:15234146-15234168 CCCAGGAACCTGCCTGGAGAGGG - Intergenic
987451369 5:18088225-18088247 CAAATGAACCTGCACGTGGAAGG + Intergenic
988778234 5:34496359-34496381 CTGAAGAAGCTGCATAGGGAGGG + Intergenic
988860511 5:35273183-35273205 CAGAGGTAACTGGATAGGGAGGG - Intergenic
989332231 5:40273479-40273501 CACAGCAACCTGCATGGGATTGG - Intergenic
989528990 5:42484790-42484812 CATAGGAAACTGCATAGGAAAGG - Intronic
992232357 5:74675888-74675910 CAGAGGAAATTGAGTGGGGAGGG + Intronic
992243408 5:74793403-74793425 CACAGCAACCTGCATGGAGTTGG + Intronic
996385607 5:122906924-122906946 CAGAGTAAGCTGCATGAGCAGGG - Intronic
999149233 5:149415797-149415819 CAGAGGAAGCTGCATGTTCAAGG - Intergenic
999378789 5:151105460-151105482 CAGAGGAGGAAGCATGGGGAAGG - Intronic
999458392 5:151736996-151737018 CTGAGGAACCACCATAGGGAAGG + Intergenic
1001586524 5:172836598-172836620 CGGAGGAAGGTGCATGGGGATGG - Intronic
1001770552 5:174292979-174293001 CACAGGGGCCTGCAAGGGGAAGG + Intergenic
1002067395 5:176658840-176658862 CAGAGGGACCTACAGGGGCATGG - Exonic
1002079358 5:176728270-176728292 CAGAGGACCCAGCATGCAGAAGG - Intergenic
1002165001 5:177338526-177338548 AAGAAGAACCTCCATGGAGACGG - Exonic
1002209271 5:177586608-177586630 CAGAGGCAACTACATGGGGACGG + Intergenic
1002293708 5:178216539-178216561 AAAAGGAACCACCATGGGGAGGG + Intronic
1006795651 6:36730781-36730803 CAGAGGATTCTGCAAGGGGGGGG - Intronic
1013189402 6:107789427-107789449 CAGAGGAACCCGCCTGGAAAGGG - Intronic
1014242047 6:119028432-119028454 TAGAGGACCCTGTATGGGGCTGG - Intronic
1018921299 6:168177715-168177737 AGGAGGAGCCTGCGTGGGGAAGG - Intergenic
1019070542 6:169341334-169341356 CAGAGGAACCTCCTAGGTGATGG - Intergenic
1019165087 6:170093502-170093524 CAGAGGCTCCTGGCTGGGGAAGG - Intergenic
1019914478 7:4123946-4123968 CAGAGGAACCTGCAGAGCAAAGG - Intronic
1020872473 7:13649110-13649132 CAGAGGGACCTGCAAGTGTAGGG - Intergenic
1021088454 7:16451949-16451971 CAGAGGAACCTGCAAAGCGAGGG - Intergenic
1021226487 7:18033896-18033918 CACAGCAACCTGCATGGAGTTGG - Intergenic
1022425198 7:30262003-30262025 CAGAGGAAACTGCAGTGGGTTGG + Intergenic
1022482337 7:30752341-30752363 CCAAGGAACCTGGATGGGGATGG + Intronic
1022508479 7:30921222-30921244 CGGGGGCAGCTGCATGGGGAGGG + Intronic
1023388577 7:39685262-39685284 CAGAGGAAGCTGCATGGCAAAGG + Intronic
1023723080 7:43114552-43114574 CAGAGGAAGCAGCAAGCGGAGGG - Intronic
1023835593 7:44065547-44065569 CAGAGGACTCTGGACGGGGACGG + Exonic
1024096699 7:45987828-45987850 CAGAGGGACATACAGGGGGAGGG + Intergenic
1024295603 7:47839582-47839604 CTGATGAACCAGCCTGGGGAAGG + Exonic
1027534271 7:79376890-79376912 CACAGGAAGCTGCATATGGATGG - Intronic
1027729164 7:81847930-81847952 CAGAGGACACTGCATGTGCAAGG + Intergenic
1034432169 7:151046533-151046555 CAGCGGCACCAACATGGGGAGGG - Intronic
1036755941 8:11471197-11471219 CAGAGGGAACTGCATCTGGAAGG + Intronic
1037569724 8:20148062-20148084 CAGAGGAACCTGCATGGGGAAGG + Exonic
1037905507 8:22713906-22713928 CAGGGGAGCCTGCAGGGAGAGGG - Intronic
1039396280 8:37227900-37227922 GAGAGGAAGGTGCAGGGGGAAGG - Intergenic
1039981168 8:42410981-42411003 CCGAGGAAGCGGCATGCGGAAGG - Intergenic
1040555839 8:48476896-48476918 CAGAGGAGGCTGCATGGCCAGGG - Intergenic
1041770147 8:61464595-61464617 CAGAGAAGCCTCCATGTGGAAGG + Intronic
1042448904 8:68922010-68922032 CAGAGGATTCTGGCTGGGGATGG - Intergenic
1042646929 8:70997459-70997481 CACAGCAACCTGGATGGAGATGG + Intergenic
1046796696 8:118381252-118381274 CAGTGGAACCTGCATTTGTAAGG + Intronic
1047312800 8:123706608-123706630 CAGAGGAACTTGCATGTGGGTGG - Intronic
1048800401 8:138189214-138189236 CAGAGGCATCTGGCTGGGGATGG + Intronic
1049337737 8:142095562-142095584 CTGAGGAACCTTACTGGGGAGGG + Intergenic
1049420304 8:142513510-142513532 CAAAGGAACCTGCCAGGGGCAGG - Intronic
1050043694 9:1521570-1521592 CACAGTAGCCTGCATGGTGATGG - Intergenic
1050220491 9:3383777-3383799 CAGAGTGTTCTGCATGGGGATGG + Intronic
1051842524 9:21414530-21414552 CAGAGGGACCTGAATGGGTGGGG - Intronic
1055222875 9:73959194-73959216 CTGAGGAAGCAGCCTGGGGATGG + Intergenic
1055787738 9:79888312-79888334 CCGAGGAACATGCATGGAAATGG - Intergenic
1057691277 9:97288717-97288739 CAAAGGAAGCTGCATGGACATGG + Intergenic
1057872079 9:98725771-98725793 GACAGGAACCTGCATTGAGAGGG - Intergenic
1059163036 9:112053090-112053112 CAGAGGAAGCTGCACGGTGAGGG + Intronic
1060805681 9:126574691-126574713 CTGGGGAACATGTATGGGGATGG - Intergenic
1060877668 9:127094911-127094933 CATAAGAAACTGCCTGGGGAGGG - Intronic
1060888692 9:127174646-127174668 CACAGGAACCTGTTTGGGGCTGG - Intronic
1061048548 9:128180672-128180694 CAGAGGGACATGAATGGGGTGGG - Intronic
1061513253 9:131073449-131073471 CAGTGTCACCAGCATGGGGAGGG + Intronic
1061764047 9:132870140-132870162 TACAGGAACCTGGAAGGGGAGGG - Intronic
1062250574 9:135591809-135591831 CCAAGGACCCTGCCTGGGGAGGG - Intergenic
1062541105 9:137041952-137041974 AAGAGCAAGCTGCCTGGGGACGG + Intronic
1062595479 9:137297155-137297177 CAAAGGGGCCTGCCTGGGGAGGG + Intergenic
1062610108 9:137369710-137369732 CAGAGGAGCCTGGGTGGGGCTGG + Intronic
1185526557 X:784874-784896 CAGAGGAAGCTGAATGGGTCAGG - Intergenic
1186136836 X:6530121-6530143 CAAAGGAAGCTGCATGGTCAAGG + Intergenic
1186267506 X:7848309-7848331 CAGAGGAAGCTGCATGGTCAAGG - Intergenic
1186297539 X:8166560-8166582 CAGAGGAAGCTGCATGGTCAAGG + Intergenic
1186376661 X:9010699-9010721 CGGAGGAAGCTGCATGGTCAAGG - Intergenic
1188112499 X:26208713-26208735 CAGAGGATCCTGCATTATGAGGG + Intergenic
1189528179 X:41848737-41848759 CAAAGGAGGCTGAATGGGGATGG - Intronic
1190292360 X:49001330-49001352 AACAGGGTCCTGCATGGGGAGGG - Intronic
1191156774 X:57283086-57283108 CATGGGAACCTGCCTGGGGATGG + Intergenic
1191270125 X:58454841-58454863 CATTGGTACCTTCATGGGGATGG + Intergenic
1192552267 X:72063957-72063979 CAGAGAAAGCTTCATGGGGGAGG + Intergenic
1193814588 X:86089818-86089840 CACAGCAACCTGGATGGGGTTGG + Intergenic
1194870122 X:99119533-99119555 CACAGGAGCCTGTTTGGGGATGG - Intergenic
1195177954 X:102328915-102328937 CACAGGAACCTCCATGTGGAAGG + Intergenic
1195180910 X:102358178-102358200 CACAGGAACCTCCATGTGGAAGG - Intergenic
1195534748 X:105998610-105998632 CACAGGAACATGGATGGAGATGG + Intergenic
1195801954 X:108722652-108722674 CAGAGGAGACTGCCTGGGCATGG + Intronic
1196779891 X:119374461-119374483 CAGAAGAAACTGCATGTGCAAGG + Intergenic
1198328073 X:135594400-135594422 CACTGGAACCTACCTGGGGATGG + Intergenic
1198564406 X:137889567-137889589 CAAAGGAACCTGCAAGGGCCAGG + Intergenic
1199731469 X:150637308-150637330 CAGAGGAAAATGGTTGGGGAGGG + Intronic
1201438215 Y:13981665-13981687 CAGAGGAAGCTGCATGGTCAAGG + Intergenic
1201446365 Y:14060440-14060462 CAGAGGAAGCTGCATGGTCAAGG - Intergenic
1201941658 Y:19466794-19466816 AAGACAAACCTGCATGGGGAAGG + Intergenic