ID: 1037570601

View in Genome Browser
Species Human (GRCh38)
Location 8:20154834-20154856
Sequence CAGCGCTCAGCCGTGGTGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 180}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037570601_1037570611 24 Left 1037570601 8:20154834-20154856 CCGTCCACCACGGCTGAGCGCTG 0: 1
1: 0
2: 3
3: 23
4: 180
Right 1037570611 8:20154881-20154903 CCACCCCTCCAGATCTGGCAGGG 0: 10
1: 42
2: 98
3: 150
4: 311
1037570601_1037570608 19 Left 1037570601 8:20154834-20154856 CCGTCCACCACGGCTGAGCGCTG 0: 1
1: 0
2: 3
3: 23
4: 180
Right 1037570608 8:20154876-20154898 GACTTCCACCCCTCCAGATCTGG 0: 21
1: 71
2: 95
3: 106
4: 191
1037570601_1037570609 23 Left 1037570601 8:20154834-20154856 CCGTCCACCACGGCTGAGCGCTG 0: 1
1: 0
2: 3
3: 23
4: 180
Right 1037570609 8:20154880-20154902 TCCACCCCTCCAGATCTGGCAGG 0: 10
1: 44
2: 86
3: 145
4: 272

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037570601 Original CRISPR CAGCGCTCAGCCGTGGTGGA CGG (reversed) Intronic
900524463 1:3121735-3121757 CAGCGCGCAGCCGAGGTGGAGGG - Intronic
900591908 1:3463921-3463943 CCGCTCCCAGCCTTGGTGGAGGG + Intronic
901062357 1:6477707-6477729 CAGCGCTGGGCCGGGGTCGAGGG - Intronic
903500999 1:23800229-23800251 CAGCGGGCAGCGGTGGGGGAAGG - Intronic
904489501 1:30849694-30849716 CAGGGCTCAGCCGTGCTGCTGGG + Intergenic
905381789 1:37567276-37567298 CAGCACTCAGCCTTGCTGCAGGG - Intronic
905459919 1:38115863-38115885 CACCCCTCAGCCCTGGGGGAGGG + Intergenic
907602971 1:55788566-55788588 CGGTGAACAGCCGTGGTGGACGG + Intergenic
907992283 1:59594604-59594626 GAGCACTCAGCCTTGGTGGGAGG - Intronic
910642829 1:89481824-89481846 CCGGGCACAGTCGTGGTGGAAGG + Intergenic
912383260 1:109258915-109258937 CAGCCCTCCGACGGGGTGGATGG - Exonic
917097538 1:171414075-171414097 CGGCATTCAGCAGTGGTGGACGG + Intergenic
920405249 1:205704203-205704225 GAGCGCTGAGACATGGTGGATGG + Intergenic
922526538 1:226308799-226308821 CGGCCCCCAGCCGAGGTGGAGGG - Intronic
922597055 1:226822194-226822216 CTGCACTCAGCAGTGGTGGGAGG - Intergenic
922619218 1:226980158-226980180 CAGAGCTCAGCCAGGGTGGCCGG - Intronic
922683933 1:227624877-227624899 CAGCGATCAGCAGTGGTGGACGG + Intronic
923998187 1:239520513-239520535 AAGCACTCAGTCATGGTGGAGGG - Intronic
924470202 1:244336656-244336678 CAGGGCTGAGGTGTGGTGGAAGG - Intergenic
1065730411 10:28704990-28705012 CAGCGCTCAGGGGTGGGTGAGGG + Intergenic
1067088274 10:43254100-43254122 CAGAGCACAGCCCTGGTGGGAGG - Intronic
1067478881 10:46582914-46582936 CAGCTCTCAGCCAGGGCGGAAGG - Intronic
1067615857 10:47758887-47758909 CAGCTCTCAGCCAGGGCGGAAGG + Intergenic
1068988851 10:63131015-63131037 CAGCAAACAGCGGTGGTGGACGG + Intergenic
1069037966 10:63665000-63665022 CAGCGAACAGCAGTGGTGGATGG + Intergenic
1070501602 10:77077979-77078001 CAGCAGTCAGCCGTTCTGGATGG + Intronic
1070570759 10:77638055-77638077 CAGCGCACACCCGTGGCGCACGG - Intronic
1071475129 10:86019283-86019305 CAGAGCACAGCTGGGGTGGAGGG - Intronic
1071556992 10:86612081-86612103 CGGCAAACAGCCGTGGTGGACGG - Intergenic
1074978467 10:118599889-118599911 CGGCAATCAGCAGTGGTGGACGG + Intergenic
1075729028 10:124625476-124625498 CAGCTCTCTGCCGTGGTGAGGGG - Intronic
1076356421 10:129857015-129857037 CAGAGCCCAGCAGTGGGGGAAGG + Intronic
1081070858 11:38606845-38606867 CAGCAAACAGCAGTGGTGGAAGG - Intergenic
1083303326 11:61750078-61750100 CAGTGGCCAGCCGTGGGGGAGGG - Intergenic
1085900977 11:80699570-80699592 CAGTGCTCAGCAGTGGTGGACGG + Intergenic
1087757780 11:102073385-102073407 CAGATGTCAGCAGTGGTGGAGGG + Intronic
1087901304 11:103644892-103644914 CGGCGTTCAGCAGTGGTGGACGG + Intergenic
1088242923 11:107789629-107789651 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1091544917 12:1495225-1495247 CAGTGCTCACCCGTGCTGGGTGG - Exonic
1096677554 12:53233767-53233789 CAGCTCTCAGCAGTGTGGGAGGG + Intergenic
1097699602 12:62806698-62806720 AAACGTTCAGTCGTGGTGGAAGG - Intronic
1098984869 12:77001448-77001470 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1102536177 12:113583186-113583208 CACAGCTCTGCAGTGGTGGAGGG + Intergenic
1103614286 12:122142321-122142343 CAGCACCCAGCCCTTGTGGATGG + Exonic
1103872345 12:124100842-124100864 CGGCAATCAGCAGTGGTGGATGG + Intronic
1103873182 12:124106016-124106038 CGGCGATCAGCAGTGGTGGAGGG + Intronic
1104597275 12:130128388-130128410 CAGAGCTCAGCCGTGACGGGCGG - Intergenic
1104850971 12:131873564-131873586 CAGCAAGCAGCAGTGGTGGATGG + Intergenic
1107719263 13:43230714-43230736 CAGCCCTGAGCGGTGGGGGAGGG - Intronic
1109380903 13:61558304-61558326 CAGTGATCAGCAGTGGTGGACGG + Intergenic
1111690368 13:91556077-91556099 CAGGGGTCAGAAGTGGTGGAAGG - Intronic
1111910276 13:94303076-94303098 CAGCAAACAGCAGTGGTGGATGG + Intronic
1113592280 13:111509370-111509392 CGGCGATCAGCAGTGGTAGACGG + Intergenic
1113807157 13:113116608-113116630 CAGGGCCCAGGGGTGGTGGAAGG - Intronic
1114384823 14:22243779-22243801 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1115961302 14:38837894-38837916 TAGGGCTCTGCCGTGGTGGCCGG - Intergenic
1117326171 14:54671012-54671034 CAGAGCTCAGGCGTGGCTGAGGG + Intronic
1118437009 14:65780642-65780664 CAGGGCAAAGCAGTGGTGGAAGG + Intergenic
1120097376 14:80403859-80403881 CAGTGATCAGCAGTGGTGGACGG - Intergenic
1120107987 14:80517978-80518000 CAGCAAACAGCAGTGGTGGACGG + Intronic
1123987289 15:25657029-25657051 CGGCGAACAGCAGTGGTGGACGG - Intergenic
1126153889 15:45547395-45547417 CAGCGAACAGCAGTGGTGGATGG + Intergenic
1129305172 15:74655547-74655569 CAGCATTCTGCCATGGTGGAGGG - Intronic
1129608485 15:77036259-77036281 CAGCGCCCAGCCTGTGTGGACGG - Intronic
1132481106 16:166502-166524 CAGCGCGCAGCCGGGGTGGGGGG + Intronic
1136249919 16:28997709-28997731 CCGCGCCCGGCCGAGGTGGAAGG - Intergenic
1138792968 16:59929953-59929975 CAACTCTCAGCCATGGTGCAGGG - Intergenic
1140078681 16:71724096-71724118 CAGCGCTCTGCGGTGGTGCCAGG - Intronic
1144669846 17:17126738-17126760 CAGTGCACAGATGTGGTGGATGG + Exonic
1147609456 17:41793099-41793121 CAGCGGCCAGTGGTGGTGGAGGG + Intergenic
1148229014 17:45919560-45919582 CTGCGCCCAGCAGTGGGGGAAGG - Intronic
1151445286 17:74159728-74159750 CAGGGGTCATCTGTGGTGGAGGG - Intergenic
1153400773 18:4682045-4682067 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1153545899 18:6204381-6204403 CAGGGCTCAGCTGTGGGAGAAGG - Intronic
1158465027 18:57682292-57682314 CCGCGCCCAGCCCTGCTGGAAGG + Intronic
1160940591 19:1618837-1618859 CAGCGCTCAGCACTGGGGAAGGG - Intronic
1161068828 19:2250619-2250641 CAGGGCTCAGCCCGGCTGGATGG - Intronic
1161476949 19:4491467-4491489 CAGAGCTCAGCTGTCGTGGGTGG + Intronic
1162825612 19:13249736-13249758 CAGGGCTCTGCTGAGGTGGAGGG + Intronic
1164173170 19:22745520-22745542 CAGCAAACAGCAGTGGTGGATGG - Intergenic
925023807 2:592583-592605 CAGCAAACAGCAGTGGTGGAGGG - Intergenic
925361860 2:3285345-3285367 CAGGTCCCAGCTGTGGTGGACGG + Intronic
928347674 2:30516323-30516345 CGACGTTCAGCAGTGGTGGACGG - Intronic
928440099 2:31285090-31285112 CGGCAATCAGCAGTGGTGGACGG - Intergenic
928968920 2:37006396-37006418 CAGCACCCAGCCGAGGTGGGTGG + Intronic
930631150 2:53756757-53756779 CGGTGATCAGCAGTGGTGGACGG - Intronic
931471321 2:62540440-62540462 CAGCTCTAAGCAGAGGTGGAAGG - Intergenic
932313890 2:70767384-70767406 CGGCGCTCAGCCGCAGTGGCCGG - Intronic
934663728 2:96156437-96156459 CATCTCTCAGCCAAGGTGGAGGG - Intergenic
935748347 2:106209327-106209349 CAGCAAACAGCAGTGGTGGATGG - Intergenic
937253480 2:120538988-120539010 CAGCCCTCAGCCTTTGTGCATGG - Intergenic
939875948 2:147577931-147577953 CAGCTCTCTGGCTTGGTGGAGGG - Intergenic
941395565 2:164968911-164968933 TGGCGATCAGCAGTGGTGGACGG + Intergenic
946326549 2:218987396-218987418 CAGCGCTCAGCAGGGTAGGAAGG - Intergenic
948066939 2:235087909-235087931 CAGCGTTCACCCGTGCTGGCGGG - Intergenic
948908390 2:240990924-240990946 CACCGCGCACCCTTGGTGGATGG - Intronic
1171022899 20:21602776-21602798 CAGCTCTCAACCATGGTGGATGG + Intergenic
1173293969 20:41739415-41739437 CAGCCCTCGCCCATGGTGGAGGG + Intergenic
1173667520 20:44773570-44773592 CAGCGCTCAGCAGAGAGGGAGGG - Intronic
1173755605 20:45512944-45512966 CAGAGCACAGCCATTGTGGATGG - Intronic
1176184091 20:63768733-63768755 CCGCGCAGAGCCCTGGTGGAAGG - Intronic
1177263980 21:18760153-18760175 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1178855399 21:36246197-36246219 CAGGGCCCTGCCGTGGTGGGCGG - Exonic
1179576791 21:42312987-42313009 CCTCTCTCTGCCGTGGTGGAGGG - Intronic
1179801307 21:43812703-43812725 CAGCGCCCAGCCGTAGACGAGGG + Intergenic
1180737077 22:18025069-18025091 CAGCGCAGAGCCCTGGGGGAGGG + Intergenic
1184161242 22:42698549-42698571 CAGCACTCAGCCTGGATGGAGGG - Intronic
1184255834 22:43286393-43286415 CTGGCCTCAGCCTTGGTGGAAGG - Intronic
949260677 3:2099514-2099536 GAGCCCGTAGCCGTGGTGGAAGG + Intronic
949811676 3:8012972-8012994 CAGCAAACAGCAGTGGTGGATGG + Intergenic
950543279 3:13624884-13624906 CAGCGCTAAGCCAGTGTGGAAGG - Intronic
950724252 3:14906292-14906314 CAGAGCTCAGCCGCCATGGAGGG - Intronic
951016256 3:17735811-17735833 CAGCAAACAGCAGTGGTGGATGG + Intronic
953515821 3:43591187-43591209 CGGCGAACAGCAGTGGTGGATGG - Intronic
953627183 3:44580701-44580723 CAGTGCACAGATGTGGTGGATGG - Intronic
953787333 3:45921143-45921165 CAGAACTCAGCAGTGTTGGAGGG - Exonic
957000509 3:74877945-74877967 CAGCAAACAGCAGTGGTGGATGG + Intergenic
957687039 3:83515284-83515306 CAGCAAACAGCAGTGGTGGACGG - Intergenic
958457051 3:94345318-94345340 CAGTGAACAGCAGTGGTGGACGG + Intergenic
959406341 3:105966161-105966183 CAGCGATCGGCAGTGGTTGACGG - Intergenic
959515651 3:107263862-107263884 CAGGCCTCAGCTGTGGTGGGAGG - Intergenic
959885721 3:111497404-111497426 TGGCGTTCAGCCATGGTGGATGG + Intronic
963255679 3:143142484-143142506 CGGCGTTCAGCAGTGGTGGATGG - Intergenic
964224493 3:154382362-154382384 CAGAGCTCAACCAAGGTGGATGG + Intronic
966994303 3:185265012-185265034 CGGCACTCAGCAGTGGTGGATGG - Intronic
968178097 3:196568743-196568765 CCGCGCTGAGCCGCGGAGGAGGG + Exonic
969645654 4:8427399-8427421 CAGCCATCAGCAGTGGTGGATGG - Intronic
970049255 4:11895163-11895185 CATCGCAGAGCAGTGGTGGAAGG - Intergenic
971076770 4:23158374-23158396 CAGCGTACAGCAGGGGTGGATGG - Intergenic
971824498 4:31603945-31603967 CAGCCTTCAGCCGTGGCTGAAGG + Intergenic
974190486 4:58496555-58496577 TGGCGATCAGCAGTGGTGGACGG + Intergenic
974487853 4:62526898-62526920 CAGCAAACAGCAGTGGTGGACGG + Intergenic
974841794 4:67307594-67307616 CAGAGAACAGCAGTGGTGGATGG - Intergenic
975418825 4:74138679-74138701 CAGCAAACAGCAGTGGTGGATGG + Intronic
976189289 4:82473690-82473712 CAGCAATCAGCAGTGGTAGATGG - Intergenic
976190167 4:82479711-82479733 CAGCAATCAGCAGTGGTGGATGG - Intergenic
977556174 4:98489576-98489598 CGGCAATCAGCAGTGGTGGACGG - Intronic
980190519 4:129519325-129519347 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980523646 4:133961712-133961734 CAGCAAACAGCAGTGGTGGACGG - Intergenic
984257778 4:177408296-177408318 CAGCAATCAGCAGTGGCGGACGG + Intergenic
985510417 5:310109-310131 CTGGGCTCAGCCCTGGTGCAGGG + Intronic
987855123 5:23411299-23411321 CGGCGATCAGCAGTGGTGGACGG - Intergenic
987934919 5:24451359-24451381 CAGCATTCAGCAGTGATGGACGG + Intergenic
990210696 5:53479869-53479891 TAGCGCTCTGCCAGGGTGGAAGG + Intergenic
990905177 5:60795614-60795636 CGGCATTCAGCCCTGGTGGATGG - Intronic
993622826 5:90188273-90188295 CGGCGTTCAGCAGTGGTGGACGG + Intergenic
995717278 5:115092614-115092636 CAGCTATCAGCAGTGGTGGATGG - Intergenic
996939816 5:128990943-128990965 CGGAGATCAGCAGTGGTGGACGG + Intronic
997467426 5:134097637-134097659 CAGCCCTCACCCACGGTGGAGGG + Intergenic
999267935 5:150278975-150278997 CAGCCCTCAGCCCTGCTGGGAGG + Intronic
999642239 5:153683130-153683152 CAGAGCTCAGACCTGATGGATGG + Intronic
1004236359 6:13878455-13878477 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1005640543 6:27792163-27792185 CAGCAATCAGCTGTGGTGTAGGG - Intergenic
1006940505 6:37748908-37748930 CAGCCCTCATCAGTGATGGATGG + Intergenic
1009351426 6:62684253-62684275 CAGTGATCAGCAGTGGTGGACGG + Intergenic
1009394092 6:63177317-63177339 CAGTGCTCATCAGTGGTGGATGG - Intergenic
1009519551 6:64664074-64664096 CAGGGATCAGTAGTGGTGGACGG + Intronic
1011190324 6:84720755-84720777 CAGCGAACAGCAGTGGTGGATGG + Intronic
1011826985 6:91319222-91319244 CAGGGCTCTGCCCTGGTGAACGG + Intergenic
1013467609 6:110430953-110430975 AACAGCTCAGCAGTGGTGGAAGG + Intronic
1015632764 6:135247944-135247966 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1016834784 6:148466332-148466354 CTGCACTCAGCCGTGGAGAATGG + Intronic
1019316963 7:391309-391331 CAGCCCTCAGCCCTAGGGGAGGG + Intergenic
1020050957 7:5081365-5081387 CCGCGCTGGGCCGTGGTGGGGGG - Intergenic
1020276173 7:6625944-6625966 CCGCGCCCAGCCTTGCTGGATGG + Intergenic
1021144253 7:17065920-17065942 CAGCGAACAGCAGTGGTGGACGG - Intergenic
1021517227 7:21502246-21502268 CAGACATCAGCCGTGGTGTATGG + Intronic
1021894567 7:25221997-25222019 CAGCCCTCAGCCCTGGGGCATGG - Intergenic
1023282935 7:38590385-38590407 CGGCATTCAGCAGTGGTGGATGG + Intronic
1024148021 7:46536784-46536806 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1024556211 7:50605303-50605325 CAGAGCGCAGCCCTGGAGGAGGG - Exonic
1026891659 7:73986046-73986068 CAGCTCCCTGCCATGGTGGAGGG - Intergenic
1026923726 7:74174518-74174540 CTGCGCTCAGCCGGGGCGGCGGG + Intronic
1029477306 7:100792586-100792608 GAGCGTTCAGCAGAGGTGGACGG - Intronic
1032425796 7:131821204-131821226 CGGCATTCAGCAGTGGTGGAGGG + Intergenic
1034707081 7:153155210-153155232 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1035672620 8:1431903-1431925 CAGGGTTCAGCCCTGATGGATGG - Intergenic
1037570601 8:20154834-20154856 CAGCGCTCAGCCGTGGTGGACGG - Intronic
1037802790 8:22044335-22044357 CAGCTGTCTGCAGTGGTGGAAGG + Intronic
1041196939 8:55410206-55410228 CAGCGAGCAGCAGTGGAGGATGG - Intronic
1043489036 8:80729509-80729531 CAGGTTTCAGCTGTGGTGGAGGG - Intronic
1044988295 8:97774203-97774225 CGGCGAACAGCAGTGGTGGACGG + Intergenic
1045664320 8:104468926-104468948 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1047276649 8:123410761-123410783 CAGCAAACAGCAGTGGTGGACGG - Intronic
1049348539 8:142151966-142151988 CAGCTCACAGCCGTGGGCGAGGG - Intergenic
1051699196 9:19801422-19801444 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1051970178 9:22878077-22878099 CAGCCAACAGCAGTGGTGGACGG + Intergenic
1057179559 9:93022406-93022428 CAGCGGTCAGCAGGGGTGAAAGG + Intronic
1060793939 9:126502514-126502536 CAGGGCTGAGCCGTGGAGGAAGG + Intronic
1062250106 9:135589559-135589581 CAGGACCCAGCCGTGGGGGAGGG - Intergenic
1062449817 9:136610749-136610771 CAGCGCTCAGCAGTGGACGGTGG + Intergenic
1185504351 X:620221-620243 CAGGCCTCAGCCGGGGAGGAAGG + Intergenic
1185560908 X:1060072-1060094 CGGCGTTCAGCAGTGGTGGACGG - Intergenic
1188285579 X:28322485-28322507 CGGCGAACAGCAGTGGTGGACGG - Intergenic
1189152100 X:38719513-38719535 CGGCGAACAGCAGTGGTGGACGG + Intergenic
1192853931 X:74987161-74987183 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1192960997 X:76130737-76130759 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1193172388 X:78350375-78350397 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1196683858 X:118495051-118495073 CAGCTCTCCCCCGTGGGGGACGG + Intergenic
1196993630 X:121356620-121356642 TGGCGATCAGCAGTGGTGGACGG - Intergenic
1198605383 X:138331690-138331712 CAGCAATCAGCCTTGGTGAATGG + Intergenic
1198862326 X:141084345-141084367 CGGCGTTCAGCGGTGGTGGACGG - Intergenic
1198900368 X:141503041-141503063 CGGCGTTCAGCGGTGGTGGACGG + Intergenic
1199536297 X:148906769-148906791 CGGCATTCAGCAGTGGTGGACGG - Intronic
1200415982 Y:2910352-2910374 CGGCGATCAGCAGTGGTGAACGG + Intronic
1201329227 Y:12800001-12800023 CGGCATTCAGCAGTGGTGGAAGG - Intronic
1201724349 Y:17136736-17136758 TAGCATTCAGCAGTGGTGGATGG + Intergenic