ID: 1037570608

View in Genome Browser
Species Human (GRCh38)
Location 8:20154876-20154898
Sequence GACTTCCACCCCTCCAGATC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 484
Summary {0: 21, 1: 71, 2: 95, 3: 106, 4: 191}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037570604_1037570608 -4 Left 1037570604 8:20154857-20154879 CCATCACAGACCCACCATTGACT 0: 3
1: 5
2: 39
3: 69
4: 235
Right 1037570608 8:20154876-20154898 GACTTCCACCCCTCCAGATCTGG 0: 21
1: 71
2: 95
3: 106
4: 191
1037570601_1037570608 19 Left 1037570601 8:20154834-20154856 CCGTCCACCACGGCTGAGCGCTG 0: 1
1: 0
2: 3
3: 23
4: 180
Right 1037570608 8:20154876-20154898 GACTTCCACCCCTCCAGATCTGG 0: 21
1: 71
2: 95
3: 106
4: 191
1037570602_1037570608 15 Left 1037570602 8:20154838-20154860 CCACCACGGCTGAGCGCTGCCAT 0: 1
1: 0
2: 1
3: 15
4: 125
Right 1037570608 8:20154876-20154898 GACTTCCACCCCTCCAGATCTGG 0: 21
1: 71
2: 95
3: 106
4: 191
1037570603_1037570608 12 Left 1037570603 8:20154841-20154863 CCACGGCTGAGCGCTGCCATCAC 0: 1
1: 0
2: 0
3: 11
4: 121
Right 1037570608 8:20154876-20154898 GACTTCCACCCCTCCAGATCTGG 0: 21
1: 71
2: 95
3: 106
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037570608 Original CRISPR GACTTCCACCCCTCCAGATC TGG Intronic
904397181 1:30229833-30229855 GACTTCCACCCCTCCGGATCCGG + Intergenic
905302859 1:36997565-36997587 CACCTCCACCGCTCCAGATGTGG - Intronic
905860872 1:41350195-41350217 GACTTCCACCGCCCCAGGACAGG - Intergenic
906507522 1:46391143-46391165 GACTTCCATCCCTCTGGATCCGG - Intergenic
907067398 1:51499127-51499149 GACTTCCTGGCCTCCAGAACTGG + Intronic
907360077 1:53907104-53907126 GACTTCTACCCCGCCAGCCCTGG - Intronic
907504954 1:54911330-54911352 GACTTTCATCCCTCCAAATCTGG - Intergenic
907602960 1:55788504-55788526 GACTTCCACCCCTCTGGATACGG - Intergenic
907901299 1:58743854-58743876 GACTTCCAACTCTCCAGAGTGGG + Intergenic
908717667 1:67087559-67087581 GATTTCCACCCCTCCAGATCTGG + Intergenic
908723220 1:67148186-67148208 GACTTCCACCCCTCTGGATCCGG - Intronic
908892687 1:68863887-68863909 GACTTCCACCCCTCTGGATCCGG + Intergenic
910116675 1:83739168-83739190 GACTTCCATCCCTCTGGATCCGG - Intergenic
910590515 1:88924688-88924710 GACTTCCATCTCTCCAGATCCGG + Intergenic
911217002 1:95205868-95205890 GACTTCCCAACCTCCAGAACTGG - Intronic
911744056 1:101419576-101419598 CACTGCCACCCCTGCAGGTCTGG + Intergenic
912165136 1:107034592-107034614 GACTTCCAAGCCTCCAGAATTGG - Intergenic
912413383 1:109492637-109492659 CACCTCCTCCCCTCCAGATCCGG + Exonic
912463398 1:109852554-109852576 GACTTCCGCCCCTCTGGATCCGG - Intergenic
912716731 1:111989007-111989029 CACTTCCACCCCGCGAGCTCTGG - Exonic
912798652 1:112707289-112707311 GGCGTCCACCCCTCCAGGTCGGG + Intronic
913470777 1:119183088-119183110 GACTTCCAACCCTCTGGATCTGG - Intergenic
913682801 1:121202889-121202911 GACTTCCCAGCCTCCAGAACCGG - Intronic
914034643 1:143990514-143990536 GACTTCCCAGCCTCCAGAACCGG - Intergenic
914154809 1:145077454-145077476 GACTTCCCAGCCTCCAGAACCGG + Intronic
916270992 1:162941242-162941264 GACTTCCATCCTTCCACAGCAGG - Intergenic
917097526 1:171414033-171414055 GACTTCCACCCCTTGGGATCTGG - Intergenic
917403527 1:174678889-174678911 GACTTCCATCCCTCCGGATAGGG - Intronic
917724030 1:177812805-177812827 GACTTCCACCCCTCCGGATCCGG + Intergenic
917767898 1:178243499-178243521 TTCTTCTTCCCCTCCAGATCTGG - Intronic
920470114 1:206221402-206221424 GACTTCCCAGCCTCCAGAACCGG - Intronic
920639846 1:207741476-207741498 GACTTCCATTCCTCCGGATCCGG - Intergenic
920744033 1:208608677-208608699 GACTTCCCAGCCTCCAGAACTGG - Intergenic
922007932 1:221551013-221551035 GACTTCCATCCCTCCAGATCAGG - Intergenic
922109366 1:222542505-222542527 GATTACCACCCCACCACATCTGG + Intronic
922327873 1:224545884-224545906 GACTTCCCAGCCTCCAGAACAGG - Intronic
922683926 1:227624835-227624857 GACTTCCATCCCTCTGGATCTGG - Intronic
922685153 1:227633120-227633142 GACTTCCACCCCTCCGGATCCGG - Intronic
922876311 1:228942554-228942576 GACTTCCATGCCTCCAGATCAGG + Intergenic
922877775 1:228953932-228953954 AACTTCCATCCCTCTGGATCTGG + Intergenic
1065222792 10:23513335-23513357 GACTTTCACCACTCCGGATCCGG - Intergenic
1066673010 10:37859415-37859437 GACTTCCATCCCTCCGGATCTGG - Intergenic
1067450491 10:46379230-46379252 GATTTCCAAGCCTCCAGTTCAGG - Intronic
1067586752 10:47480521-47480543 GATTTCCAAGCCTCCAGTTCAGG + Intronic
1068191619 10:53659794-53659816 GACTTCCATCCCTCCGGATCCGG + Intergenic
1068791290 10:61034010-61034032 GACTTCCACCCCTCCGGATCTGG - Intergenic
1068792065 10:61039475-61039497 GACTTCCACCCCTCCGGATATGG - Intergenic
1071082698 10:81831270-81831292 GACTTCCGCCCCTCTGGATCTGG - Intergenic
1071326720 10:84525692-84525714 GACTTCCACCCCTCCGGATCTGG - Intergenic
1071327409 10:84530632-84530654 GACTTCCACCCCTCTGGATCTGG - Intergenic
1071331534 10:84565528-84565550 GACTTCCATCCCTCCAGATATGG - Intergenic
1071557000 10:86612123-86612145 GACTTCCATCCCTCCGGTTCCGG + Intergenic
1071691270 10:87821775-87821797 GATTTCCCACCCTCCAGAACTGG + Intronic
1072378557 10:94841350-94841372 GACTTCCATCCCTCCAGATCTGG - Intronic
1072650317 10:97290279-97290301 GACTCCCATCCCTCCGGATCTGG + Intronic
1073034267 10:100552338-100552360 GTCTTCCACCCTTCAAAATCTGG + Exonic
1075217753 10:120553482-120553504 GACTTCCAAGCCTCCAGAACTGG + Intronic
1078191866 11:9097730-9097752 GACTTCCACCCCTCCAGATCCGG + Intronic
1079204134 11:18399172-18399194 GAGTTCCACCACTGCAGATGTGG - Intronic
1079601738 11:22317899-22317921 GACTTCCATCCCTCCGGATGCGG - Intergenic
1079934236 11:26597492-26597514 GACTTCAACCCCTCCAGATCCGG - Intronic
1081401828 11:42652836-42652858 GACATACAACCCACCAGATCTGG - Intergenic
1082737610 11:56873942-56873964 GACTTCCACCCCTCCAGATCCGG + Intergenic
1083107007 11:60368082-60368104 GACTTCTACCCCTCCGGATCTGG + Intronic
1084696434 11:70758381-70758403 GACTTCCACCCCTCCGGATCTGG + Intronic
1084878730 11:72154342-72154364 GACTTCCACCCCTCCAGATCTGG + Intergenic
1085020930 11:73207171-73207193 GATTTCCTCCACTCCAGCTCTGG + Intergenic
1085251707 11:75148216-75148238 GACATCCAACCCTCCACCTCAGG - Intronic
1085267129 11:75243531-75243553 GACTCCCCACCCTCTAGATCAGG + Exonic
1085299495 11:75449978-75450000 GACTCTTCCCCCTCCAGATCGGG - Exonic
1085601986 11:77863300-77863322 GACTTCCATCCCTCCGGATCCGG - Intronic
1085621574 11:78041727-78041749 GACTCCCATCCCTCCGGATCTGG + Intronic
1085900972 11:80699528-80699550 GATTTCCACCCCTCCGGATCCGG - Intergenic
1085913296 11:80854193-80854215 GACTTCAATCCCTTAAGATCTGG + Intergenic
1086238022 11:84655555-84655577 GAGCTCCATCTCTCCAGATCTGG - Intronic
1086511204 11:87559879-87559901 GACTTCCACCCCTCCAGATCCGG - Intergenic
1087901296 11:103644850-103644872 GACTTCCACCCCTCCAGATCCGG - Intergenic
1088242931 11:107789671-107789693 GACTTCCACCCCTCCGGATCTGG + Intergenic
1088484618 11:110328704-110328726 GACTTCCACCACTCTGGATCAGG - Intergenic
1091195726 11:133729254-133729276 GACTTCCCAGCCTCCAGACCTGG - Intergenic
1091449589 12:564181-564203 GCCTTCCCACCCTCCAGGTCTGG + Intergenic
1092293647 12:7181308-7181330 GACTTCCACCCCTCCGGATCTGG + Intergenic
1092449759 12:8591248-8591270 GACAGCCTCCCCTGCAGATCTGG + Intergenic
1093106657 12:15095419-15095441 GACTTCCATCCCTCTGGATCCGG - Intergenic
1094342934 12:29432897-29432919 GACTTCCACAAGTCCAGATTTGG - Intronic
1094641002 12:32275700-32275722 GACTCCCATCCCTCCAGATCCGG + Intronic
1095138580 12:38636662-38636684 CACTCCCACCCCTCCGGATCTGG + Intergenic
1095283468 12:40384049-40384071 GAATCCTACCCCTCCGGATCTGG + Intergenic
1095734956 12:45546779-45546801 GGATTCCACACCTGCAGATCAGG + Intergenic
1095893107 12:47253020-47253042 GACTTCCATCCCTCCAGATCAGG - Intergenic
1096352546 12:50912190-50912212 GACTTCCATCCCTCTGGATCTGG - Intergenic
1096939397 12:55325698-55325720 GACTTCCATCCCTCCAGATCTGG + Intergenic
1097840851 12:64320000-64320022 GACTTCCATCCCTCCGGATCCGG + Intronic
1098984878 12:77001490-77001512 GACTTCCACCCCTCCGGATCTGG + Intergenic
1099102478 12:78459669-78459691 GACTTCCATCACTCCAGATCTGG + Intergenic
1099605038 12:84794133-84794155 GACTTCCACCCCTCCGGATCCGG + Intergenic
1099798626 12:87429606-87429628 GACTTCCACCCCTCTGGATCCGG - Intergenic
1100205061 12:92339665-92339687 GACTTCCATGCCTCTGGATCTGG - Intergenic
1101528891 12:105556748-105556770 GACTTCCCTCCCTCCAGGTCAGG + Intergenic
1101646818 12:106638675-106638697 GACTTCCCAGCCTCCAGAACTGG - Intronic
1102828383 12:115970836-115970858 GACTCATACCACTCCAGATCAGG - Intronic
1103802560 12:123548835-123548857 GACTTCCACCCCTCCGGATCTGG + Intergenic
1103804002 12:123558420-123558442 GACTTCTAGCCGTCCGGATCCGG + Intergenic
1103872336 12:124100800-124100822 AACTTCCACCCCTCCGGATCCGG - Intronic
1104850962 12:131873522-131873544 GACTTCCACCCCTCTGGATCCGG - Intergenic
1104851963 12:131880514-131880536 GACTTCCACCTGTCCAGGTCCGG - Intergenic
1106045061 13:26131596-26131618 GGCCTCCACCCCTCCAGCACTGG + Intergenic
1106678965 13:31990281-31990303 GACTTCCCAGCCTCCAGAACTGG + Intergenic
1107156423 13:37172365-37172387 GACTTCCATCCCTCCGGATCCGG - Intergenic
1108876206 13:55054063-55054085 GACTCCCATCCCTCCAGATCCGG + Intergenic
1108877226 13:55061378-55061400 GACTCCCATCCCTCCAGATCTGG + Intergenic
1109160662 13:58969645-58969667 GACTTGCAGGCCTCCAGAACTGG + Intergenic
1109520626 13:63505544-63505566 GACTTCCATCCCTCTGGATCCGG - Intergenic
1109680711 13:65748430-65748452 GACTTCCATCCCTCCGGATCCGG - Intergenic
1109931301 13:69222053-69222075 GACTCCCATCCCTCCGGATCCGG + Intergenic
1110006113 13:70272447-70272469 GACTTCCAGACCTCCAGAACTGG - Intergenic
1110846148 13:80192470-80192492 GACTTCCATCCCTCCGGATCTGG + Intergenic
1110987072 13:81984402-81984424 GACTTCCATCCCTCCAGATCCGG - Intergenic
1111021447 13:82457723-82457745 GACTCCCATCCCTCCGGATCCGG + Intergenic
1111090491 13:83439625-83439647 GACTTCCACCCCTAGGGATCGGG + Intergenic
1111174779 13:84580089-84580111 GACTTCTGTCCCTCCAGATCCGG - Intergenic
1111536792 13:89612079-89612101 AACTTCCATCCCTCTGGATCCGG - Intergenic
1111709775 13:91796321-91796343 GACTTCCAACCCTCCAGATCCGG - Intronic
1111820402 13:93206934-93206956 GACTTCCATCCCTCCGGATCCGG + Intergenic
1112906560 13:104429628-104429650 GACTTCCCAGCCTCCAGAACTGG - Intergenic
1113534726 13:111056640-111056662 GACTTCCATCTCTCCAGATCCGG + Intergenic
1114383853 14:22236774-22236796 GACTTCCATCCCTCCAGATCTGG + Intergenic
1114384829 14:22243821-22243843 GACTTCCATCCCTCCAGATCCGG + Intergenic
1114573401 14:23691733-23691755 GACTTCCCAGCCTCCAGAACTGG - Intergenic
1114840845 14:26260623-26260645 GACTTCCATCCCTCCAGATCCGG + Intergenic
1115757571 14:36544479-36544501 GACTTCTATCCCTCCGGATCCGG - Intergenic
1116018154 14:39431656-39431678 GACTTCCTCCCCTCCAGTCCCGG + Exonic
1117171815 14:53108166-53108188 GACTTCCATCCCTCCGGATCCGG + Intronic
1118453512 14:65925215-65925237 GACTCCCAACCCTCCGGATCCGG - Intergenic
1119089937 14:71772175-71772197 GACTTCCATCCCTCCAGATCTGG - Intergenic
1120107980 14:80517936-80517958 GACTTCCACCCCTCTGGATCTGG - Intronic
1120397389 14:83985622-83985644 GACTTCCATCCCTCTGGATCCGG + Intergenic
1121103073 14:91263484-91263506 GACTTCCCGCCCTCCAGACCAGG - Intergenic
1123987298 15:25657071-25657093 GACTTCCACCCCTCCGGATCCGG + Intergenic
1124421226 15:29524713-29524735 GACTGACACCCCTCTAGATCTGG - Intronic
1124578541 15:30930630-30930652 GAGTTCCACACCACCAGGTCGGG - Exonic
1124835842 15:33195148-33195170 GGTTCCCACGCCTCCAGATCCGG + Intergenic
1125400569 15:39298131-39298153 TGATTCCACCCCTCCAGATTTGG - Intergenic
1126153883 15:45547353-45547375 GACTTCCCCCCCTCCAGATCCGG - Intergenic
1126728336 15:51655594-51655616 GACTTCCATCCCTCCGGATCCGG - Intergenic
1128801962 15:70502617-70502639 GGCCTCCACTGCTCCAGATCTGG - Intergenic
1131195062 15:90349052-90349074 TACTTCCTCCTGTCCAGATCAGG + Intergenic
1131365176 15:91832994-91833016 GACTTCCCAGCCTCCAGAACTGG + Intergenic
1131367665 15:91853744-91853766 GCCTTCCACCTCTCCAGCCCCGG + Exonic
1131420115 15:92298307-92298329 GATTTCCATCCCTCCAGATCTGG + Intergenic
1131629147 15:94157686-94157708 GACTTCCACTCCTCCAGAGCTGG + Intergenic
1135690974 16:24537620-24537642 GACATCCCCCCCTGCAGATTAGG + Intergenic
1138825390 16:60313318-60313340 GACTTACACCCTTTCAGGTCAGG + Intergenic
1141524385 16:84602461-84602483 GACTTCCACCCCCAGAGAGCAGG + Intronic
1141800899 16:86308632-86308654 AATTTCCTCCCCTCCAGACCGGG + Intergenic
1142282130 16:89154190-89154212 CACTTCCACCCCTCATGACCCGG + Exonic
1142807092 17:2376876-2376898 CATTCCCACCCCTCCAGACCTGG - Intronic
1148826725 17:50399285-50399307 GACTTCCACCCCTCTGGATCTGG - Intergenic
1148827587 17:50405263-50405285 GACTTCCACCCCTCCAGATCCGG - Intergenic
1148891376 17:50809800-50809822 GACTTCCCAGCCTCCAGAACTGG + Intergenic
1149274552 17:55018317-55018339 GACTTCCATCCCTCTCAATCCGG - Intronic
1149656646 17:58312627-58312649 GACCTCCCTCCCTCCAGAGCTGG - Exonic
1150809351 17:68344585-68344607 GGCCTCCACCCCTCCAGGTTAGG - Intronic
1151017852 17:70577627-70577649 GACTTCCACACCCCCGGATCCGG + Intergenic
1152010989 17:77716642-77716664 AACTTCCAGACCTCCAGAACAGG - Intergenic
1152656151 17:81519994-81520016 GAGTCCCACCCCTCCAGCCCTGG - Intronic
1153402061 18:4692045-4692067 GGCTTCCATCCCTTCGGATCCGG + Intergenic
1155233439 18:23796103-23796125 GACTTCCCAGCCTCCAGAACTGG + Intronic
1156662246 18:39359387-39359409 GACTTCCACCCCTCAGGGTTCGG - Intergenic
1157359228 18:46963294-46963316 GGCGTCCACCCTTCCAGAACGGG + Exonic
1157360222 18:46969221-46969243 GGCGTCCACCCTTCCAGAACGGG + Exonic
1157360822 18:47022813-47022835 GGCGTCCACCCTTCCAGAACGGG + Exonic
1157361811 18:47028728-47028750 GGCGTCCACCCTTCCAGAACGGG + Exonic
1157362612 18:47033574-47033596 GGCCTCCACCCTTCCAGAACAGG + Exonic
1157557022 18:48619552-48619574 GTTTTCCATCCCTCCAGCTCAGG - Exonic
1157630023 18:49086198-49086220 GACTTCTAAGCCTCCATATCTGG - Intronic
1157782199 18:50449472-50449494 GACTTCCATCCCTTCGGATTCGG - Intergenic
1157942681 18:51946254-51946276 GACTTCCCAGCCTCCAGAACTGG + Intergenic
1159276124 18:66223477-66223499 GACTTCCATCCCTCCAGAACCGG + Intergenic
1163702382 19:18792500-18792522 AACTTGCTCCCCTCCAGATGGGG - Intergenic
1163901134 19:20101117-20101139 GACTTCCACCCCTCCCCCTCCGG + Intronic
1164249206 19:23462205-23462227 GACAATCACTCCTCCAGATCAGG - Intergenic
1164258421 19:23549277-23549299 GCCTTCCACCCCTCCTTAGCAGG - Intronic
1164988791 19:32669616-32669638 TACTTCCACCCCGCAAGATGAGG + Intronic
1166014321 19:39968901-39968923 GACTTCCACCCCTCCGGATCCGG + Intergenic
1167976498 19:53231090-53231112 GACTTCCCAGCCTCCAGAGCTGG - Intergenic
925023815 2:592625-592647 GACTTCCATCTCTCCAGAGCCGG + Intergenic
926426734 2:12745028-12745050 GACTTCCCAGCCTCCAGAACTGG + Intergenic
926582867 2:14650023-14650045 GACTTCTCACCCTCCAGAACTGG + Intronic
926672267 2:15587550-15587572 GACTTCCCAACCTCCAGAACTGG + Intergenic
926811269 2:16757132-16757154 CCCTTCCACCCCTTCAGGTCTGG + Intergenic
928347682 2:30516365-30516387 GACTTTCACCGCTCTGGATCCGG + Intronic
928348193 2:30519920-30519942 GACTTTCACCCCTCTGGATCTGG + Intronic
928676636 2:33657583-33657605 GACTTTCACCCCTCCGGATCTGG + Intergenic
930485720 2:52008251-52008273 GACTTCCACCCCTCCAGATCTGG + Intergenic
931007883 2:57873163-57873185 GACTTCCCAGCCTCCAGAACTGG + Intergenic
931038985 2:58275792-58275814 GACTTCCATCCGTCCAGATCCGG + Intergenic
931803752 2:65784616-65784638 GACTTCCAAGCCTCCAGAACTGG - Intergenic
932917181 2:75872095-75872117 GACTTCTATCCCTCCGGATCCGG + Intergenic
933121766 2:78547007-78547029 GACTTCCACCCCTCTGGATCTGG - Intergenic
936020857 2:108993867-108993889 GACTTCCCAGCCTCCAGAACTGG - Intergenic
936157448 2:110057654-110057676 GACTTCCACCCCTGTCGATCTGG - Intergenic
936157466 2:110057760-110057782 GACTTCCACCCCTGTCGATCTGG - Intergenic
936187226 2:110313684-110313706 GACTTCCACCCCTGTCGATCTGG + Intergenic
936187244 2:110313790-110313812 GACTTCCACCCCTGTCGATCTGG + Intergenic
936868895 2:117109697-117109719 GATTTCCATCCCTCAGGATCCGG + Intergenic
937594974 2:123661610-123661632 GACTTCCACCCCTCCAGATCTGG + Intergenic
939494101 2:142907459-142907481 GACTCCCACCCCTCTGGATCTGG - Intronic
939577759 2:143916648-143916670 GACTTCCCCGCCTCCGGAACTGG - Intergenic
939824469 2:146998542-146998564 GACTTCTATCCCTCCGGATCCGG + Intergenic
940155219 2:150649043-150649065 GACTTCCTAGCCTCCAGAACTGG - Intergenic
940669046 2:156645182-156645204 GACTCCCATCCCTCCGGATCTGG + Intergenic
941395559 2:164968869-164968891 GACTTCCACTCCTCCGAATCTGG - Intergenic
941673139 2:168316657-168316679 GACTTCCTATCCTCCAGAACTGG - Intergenic
941896726 2:170636637-170636659 GCCTCCCACCCTTCCAGAGCTGG + Intronic
943179548 2:184525128-184525150 GGCTACCACCCCTCCAACTCAGG + Intergenic
943462363 2:188184647-188184669 AACTTCCATGCCTCCGGATCTGG - Intergenic
943706602 2:191041825-191041847 GGTCTCCACCCCTCCAGACCTGG + Intronic
944039787 2:195339899-195339921 GACTTCCACCCCTCCGGATCTGG - Intergenic
946941621 2:224775305-224775327 TAATTCCACCCCTACAGACCTGG - Intronic
947682650 2:232049585-232049607 GACTTCCGAGCCTCCAGAACTGG + Intronic
948517649 2:238514239-238514261 GACTTCCACCCCTCTGGATCCGG + Intergenic
1170254790 20:14328719-14328741 GGCGTACACACCTCCAGATCAGG + Intronic
1171500788 20:25591451-25591473 GACTTCCATCCCTCCGGATCTGG - Intergenic
1172888515 20:38247412-38247434 CACTTCCACCCCTCCTCACCTGG + Intronic
1172947201 20:38698786-38698808 GACTTCCACCCCTCTGGATCAGG + Intergenic
1173276253 20:41586281-41586303 GACTTTCACCCCTCCGGATCCGG + Intronic
1173842283 20:46165755-46165777 GACTTCCAAGCCTCCAGGCCTGG + Intergenic
1177263006 21:18753084-18753106 GACTCCCATCCCTCCGGATCCGG - Intergenic
1177263973 21:18760111-18760133 GACTCCCATCCCTCCGGATCCGG - Intergenic
1177359354 21:20048608-20048630 GACTTCCACCCCTCCGGATCCGG - Intergenic
1177426359 21:20927705-20927727 GATGTCCACCACTCCAGATCCGG + Intergenic
1177531189 21:22360108-22360130 GACTGCCATCCCTCCAGATCTGG - Intergenic
1177738130 21:25118817-25118839 GACTTCCACCCCTCCGGATCCGG + Intergenic
1177895737 21:26854852-26854874 GACTTCCATCCCTCTAGATCTGG + Intergenic
1177896709 21:26861686-26861708 GACTTCCATCCCTCCAGATCTGG + Intergenic
1177924999 21:27203175-27203197 GACCTCCACCCCTCCTGCACTGG + Intergenic
1177930649 21:27278908-27278930 GACTTCCTAGCCTCCAGAACTGG - Intergenic
1179259605 21:39746235-39746257 GACTTCCATTCCTCCAGATCCGG - Exonic
1179444718 21:41423201-41423223 GATGTCCACCCCTCTGGATCCGG - Intronic
1181907983 22:26214704-26214726 TTCTTCCTCCCCTCCAAATCTGG - Intronic
1184872792 22:47251615-47251637 GACTTCCCCACCTCCAGGACAGG - Intergenic
951024411 3:17814672-17814694 GACTTCTAGGCCTCCAGAACTGG - Intronic
951326069 3:21303093-21303115 GACTTCCATCCCTCCAGATCCGG - Intergenic
951837649 3:27001177-27001199 GACTTCCATCCCTCCAGATCTGG + Intergenic
952386182 3:32843216-32843238 TACTTTCACCCCCCAAGATCTGG + Intronic
952921710 3:38289740-38289762 GACTTCCACCCCTCCGGATCTGG - Intronic
952922692 3:38296887-38296909 GACTTCCACCCCTCCGAATCTGG - Intronic
953515828 3:43591229-43591251 GACTTCCATCCCTCCAGATCAGG + Intronic
954096963 3:48336059-48336081 GGCTTCCACACCTCCGGATTGGG - Intergenic
954934861 3:54317404-54317426 GACTTCCTAGCCTCCAGAACTGG - Intronic
955381271 3:58440182-58440204 GACTTCCACCCCTCTGGATCCGG - Intergenic
956564247 3:70617524-70617546 GACTTCCATCCCTCCAGATCTGG + Intergenic
956972069 3:74537807-74537829 GACCTCCATCCCTCCATCTCTGG - Intergenic
956977705 3:74600844-74600866 GACTTCCAACTCTCCAAATCTGG + Intergenic
957000501 3:74877903-74877925 GACTTCCATCCCTCCGGATCCGG - Intergenic
957687048 3:83515329-83515351 GACTTCCATCCCTCCGGATGCGG + Intergenic
957895112 3:86411998-86412020 GGCTTCCACCCTTCTGGATCCGG + Intergenic
958016741 3:87946197-87946219 GACTTCCACCCCTCTGGATCCGG - Intergenic
958091890 3:88886798-88886820 GACTTCCACCCCTCTGGATCCGG - Intergenic
958419241 3:93912648-93912670 GACTTCCCAGCCTCCAGAACTGG - Intronic
958424508 3:93965312-93965334 GACTCCCATCCCTCCGGATCCGG + Intronic
958629242 3:96666792-96666814 GACTACCATCCCTCTGGATCCGG - Intergenic
958630363 3:96675010-96675032 GACTTACATCCCTCCGGATCTGG - Intergenic
959406347 3:105966203-105966225 GACTTCCACCCTTCCAGATCCGG + Intergenic
959592750 3:108097796-108097818 TTCTTCCACCCCTCCATCTCTGG - Intergenic
960859379 3:122136000-122136022 GACTTCCCAGCCTCCAGAACTGG - Intergenic
962079304 3:132120219-132120241 GTCTTCCTCACCTCCAAATCAGG - Intronic
962492674 3:135909408-135909430 AACTTCCACCTCTCCGGTTCAGG + Intergenic
962916314 3:139907150-139907172 GACTTCCCAGCCTCCAGAACTGG - Intergenic
963255686 3:143142526-143142548 GACTTCCACCCCTCCGGATCCGG + Intergenic
963261590 3:143197248-143197270 GACTTCCCATCCTCCAGAGCTGG + Intergenic
963575890 3:147060191-147060213 GACTTCCATCCCTCCAGATCTGG + Intergenic
963915316 3:150854412-150854434 GACTTCCATCCCTCTGGATCTGG + Intergenic
965342128 3:167503668-167503690 GACTTCCATCCCTCTGGATCTGG - Intronic
966511218 3:180765634-180765656 GACTTTCACCCCTCCGGATCCGG - Intronic
966933452 3:184690626-184690648 GACTTCGGCTCCTCCAGGTCTGG + Intergenic
966994311 3:185265054-185265076 GACTCCCACCCCTCCGGATCCGG + Intronic
967717327 3:192777035-192777057 GACTTACACCCCTAGAGTTCAGG + Intergenic
967891858 3:194369486-194369508 GGCTTGCACCCCTCCAGCACAGG + Intronic
968606788 4:1539334-1539356 GACTGGCACCTCTCCAGGTCAGG - Intergenic
970095532 4:12459587-12459609 GACTTCCATCCCTGCGGATCCGG + Intergenic
971076782 4:23158416-23158438 TACTTCCACCCTTCCGGATCTGG + Intergenic
972766767 4:42158529-42158551 GACTTCCATCCCTCTGGATCTGG - Intergenic
972780832 4:42285710-42285732 GACTTCCACCTCTGCAGATCTGG - Intergenic
972781775 4:42292459-42292481 GACTCCCACCCCTGCGGATCTGG - Intergenic
972853845 4:43082259-43082281 GACTTCCATCCCTCCAGATCTGG + Intergenic
973205065 4:47550809-47550831 GACTTCCACCCCTGCGGATCTGG - Intronic
973245872 4:48010798-48010820 GACTTCCATCCCTCTGGATCCGG - Intronic
974190089 4:58493382-58493404 GACTTCCATCCCTCCAGATCTGG - Intergenic
974190479 4:58496513-58496535 GACTTCCACCCCTCTGGATCTGG - Intergenic
974487846 4:62526856-62526878 GACTTCCATCCCTCTGGATCTGG - Intergenic
974519964 4:62971434-62971456 GACTTCCAGCCCTCCGGATCCGG + Intergenic
974610605 4:64210496-64210518 GACTTCCCAGCCTCCAGAACTGG + Intergenic
974841800 4:67307636-67307658 GACTTCCACCTCTCCAGATCCGG + Intergenic
975313222 4:72925986-72926008 GACTTCCATCCCTCTGGATCCGG - Intergenic
975314187 4:72932748-72932770 GACTTCCATCCCTCCGGATCTGG - Intergenic
976190173 4:82479754-82479776 GACTTCCACCCCTCCGGATCCGG + Intergenic
976464846 4:85355202-85355224 GACTTCCACCCCTCCGGATCTGG - Intergenic
976963616 4:91009089-91009111 GACTTCCATCCCTCCAGATCTGG - Intronic
977251325 4:94692666-94692688 GAATTCCACCCCTCTGGATCCGG + Intergenic
977556181 4:98489619-98489641 GACTTCCACCCCTCCGGATCCGG + Intronic
978587023 4:110284261-110284283 GACTTCCATCCCTCCGAATCCGG - Intergenic
979136002 4:117113858-117113880 GACTTCTATCCCTCCAGATCGGG - Intergenic
979161913 4:117472501-117472523 GACCTCCACCCTTCCATCTCTGG - Intergenic
979910834 4:126363713-126363735 GACTTCCATCCCTCCAGATCTGG + Intergenic
980386298 4:132090732-132090754 GACTTCCATCCCTCTGGATCCGG - Intergenic
980443824 4:132882456-132882478 GACTTCTACCCCTCTGAATCTGG + Intergenic
980523655 4:133961754-133961776 GACTTCCACCCCTCCAGATACGG + Intergenic
980683942 4:136201408-136201430 GGCTTCCATCCTTCCGGATCTGG + Intergenic
980711596 4:136575980-136576002 GACTTCCTCCCATCCAGTTTTGG + Intergenic
981740763 4:147999475-147999497 GACTTCCATCCCTCCGGATCCGG + Intronic
983777800 4:171629921-171629943 GACTTCCATCCCTCTGGATCCGG + Intergenic
986492613 5:8307807-8307829 GACTTCCACACCTCAGGATCCGG - Intergenic
987114780 5:14717547-14717569 GACTTCCAGCCATCCTGCTCTGG - Intronic
987129616 5:14848561-14848583 GACTTCCACCCCTCCAGATTCGG + Intronic
987502699 5:18733527-18733549 GACTTCCATCCCTTCGGATCCGG - Intergenic
987508231 5:18800465-18800487 GACTTCCATCCCTCCGGATCCGG + Intergenic
987719410 5:21615313-21615335 GACTTCCACCCTTCTGGATCTGG - Intergenic
987905355 5:24069408-24069430 GACTTCCACCCCTCTGGATCTGG + Intronic
987934902 5:24451250-24451272 GACTTCCACCCCTCCAGATCCGG - Intergenic
988239837 5:28595818-28595840 GACTTCCTAACCTCCAGAACTGG - Intergenic
988486457 5:31671893-31671915 GAGCTCCACCCCTCCAGGTGAGG - Intronic
988740537 5:34064630-34064652 GACTTCCACCCCTCCAGATCCGG - Intronic
989717703 5:44483533-44483555 GACTTCCACCCCTCTGGATCCGG + Intergenic
990100420 5:52178341-52178363 GACTTCCCACCCTCCAGAACTGG - Intergenic
990741379 5:58915961-58915983 GACTTCTATCCCTCTGGATCTGG + Intergenic
990892809 5:60666118-60666140 GACTTCCACCCCTCCAGATCCGG + Intronic
990905184 5:60795656-60795678 GACTTCCAACCCTCCGGATCCGG + Intronic
991932770 5:71770646-71770668 CCCTTCCACCCATCCAGACCTGG + Intergenic
992293501 5:75304611-75304633 GACTTCCACCCCTCTGGATCTGG + Intergenic
992318025 5:75579291-75579313 GACTTCTACCCATCCAGATGGGG + Intronic
993305766 5:86272980-86273002 GACTTCCATCCCTCCGGATCTGG - Intergenic
993460754 5:88177689-88177711 GACTCCCATCCCTCCAGATCTGG - Intergenic
993640755 5:90402577-90402599 GACTTCAATTCCTCTAGATCAGG + Intronic
993941851 5:94068351-94068373 GACTTCCACCCCTCCGGATCTGG - Intronic
993982342 5:94557933-94557955 AACTTCCATCCCTCTGGATCTGG + Intronic
994958959 5:106572996-106573018 GACTTCCAAGCCTACAGAACGGG + Intergenic
995466157 5:112451134-112451156 GACTTCCATCCCTCCAGATCTGG + Intergenic
995717283 5:115092657-115092679 GACTTCCACCCCTCCGGATCTGG + Intergenic
995785076 5:115819049-115819071 GACTTCCACCCCTCCAGATCCGG - Intergenic
996038900 5:118788646-118788668 TCCTTCCACTCCTCCAGTTCAGG - Intergenic
996116726 5:119628447-119628469 GATTTCCACCCCTCCCTATTTGG + Intronic
996128277 5:119751566-119751588 GACTTCCATCCCTCCAGATCCGG + Intergenic
1000095457 5:157967411-157967433 GACTTCCATCCCTCCGGAACCGG + Intergenic
1001597151 5:172905657-172905679 GACTTCCACCCCTCTGGATCCGG - Intronic
1004256417 6:14068849-14068871 GACTTCCATCCCTCCGGATCTGG + Intergenic
1005162778 6:22883756-22883778 GGCTACCACCCCTCCAGATCTGG + Intergenic
1006574035 6:35030694-35030716 GACTTCCACCCCATCAATTCTGG + Intronic
1006937392 6:37727992-37728014 CACTTCCGCCCCTCCAGGTTTGG + Intergenic
1007011958 6:38426564-38426586 GACTTCCATTCTTCCGGATCCGG + Intronic
1009519543 6:64664033-64664055 TACTTCCATCCCTCCAGATCGGG - Intronic
1009544326 6:65005151-65005173 GACTTCCATCCCTTGAGATCTGG + Intronic
1009885211 6:69617066-69617088 GACTTCAACCCCTCTGGATCTGG + Intergenic
1010893023 6:81337370-81337392 GACTTCCATTCTTCCAGATCTGG + Intergenic
1010895033 6:81351519-81351541 GACTTCCATTCTTCCGGATCTGG + Intergenic
1011110908 6:83835814-83835836 GCCTTCCACCCAGCCAGAGCAGG - Intergenic
1011189082 6:84712026-84712048 GACTTCCACCCCTCTGGATCTGG - Intronic
1011190316 6:84720713-84720735 GACTTCCACCCCTCTGGATCTGG - Intronic
1011753711 6:90478268-90478290 GACTTCCTAACCTCCAGAACTGG + Intergenic
1012446994 6:99316657-99316679 GGGTTCCATCCCTCCAGATTGGG - Intronic
1012734535 6:102921661-102921683 GACTTCCATCCCTCCGGATCTGG - Intergenic
1013410512 6:109879641-109879663 GACTTCCACCCCTCTGGATCTGG + Intergenic
1013543079 6:111131179-111131201 GACTTCCACCCCTCTGGATCCGG + Intronic
1014208917 6:118687794-118687816 GACTTCCATCCCTCCAGATCTGG + Intronic
1014243345 6:119041699-119041721 GACTTCCACCCCTCCGGATCCGG + Intronic
1016343645 6:143087526-143087548 GACTTCCATCCCTCTGGATCTGG - Intronic
1017869001 6:158470204-158470226 GACTCCCATCCCTCCGAATCTGG - Intronic
1020432915 7:8131918-8131940 GGCTTCCACCCATGCAGATGTGG + Intronic
1020906212 7:14067252-14067274 GACTTCCATCCCTCCAGATCTGG + Intergenic
1021144257 7:17065942-17065964 GCCATCCACCCCTCCAGATCGGG + Intergenic
1023094793 7:36649799-36649821 AACTTCCATCTCTTCAGATCTGG + Intronic
1023282928 7:38590343-38590365 GACTTCTACCCCTCCAGATCTGG - Intronic
1023438997 7:40167780-40167802 GACTTCCACCCCTCCAGATCTGG - Intronic
1023439768 7:40173326-40173348 GACTTCCACCCCTCCGGATCTGG - Intronic
1023733131 7:43210802-43210824 GACTTCCACCCCTCTGGATCTGG - Intronic
1024266193 7:47608481-47608503 GACTCCCTCCACTGCAGATCTGG + Intergenic
1024318646 7:48044190-48044212 AATTTCCACCTCTCCGGATCCGG - Intronic
1025263955 7:57440426-57440448 GACTTCCAGCCTTCCAGTTCTGG - Intergenic
1025635278 7:63315682-63315704 GACTTCCAGCCTTCCAGTACTGG + Intergenic
1025647417 7:63432488-63432510 GACTTCCAGCCTTCCAGTACTGG - Intergenic
1025716573 7:63962597-63962619 GACTCCCATCCCTCCAGATCCGG - Intergenic
1026346975 7:69482847-69482869 GACTTCCACCCCTCCAGATCCGG + Intergenic
1027868359 7:83675034-83675056 GACTTCCATACCTCCGGATCCGG - Intergenic
1028298666 7:89169138-89169160 GACTTTCACTCCTCCGGATGGGG - Intronic
1028636421 7:92994402-92994424 GACTTCCCACCCTCCAGAACTGG + Intergenic
1028926146 7:96358681-96358703 GACTTCCACCCCTCTGGATCCGG - Intergenic
1029015975 7:97315973-97315995 GACTTCCATCCCTCTGGATCTGG + Intergenic
1029976811 7:104842503-104842525 GAACTCCAGCCCTCCAGATGGGG + Intronic
1030208390 7:106972737-106972759 GACTTTCACCCCTCCGGATCCGG - Intergenic
1030336812 7:108337446-108337468 GACTTCCATCCCTCTGGATCTGG + Intronic
1030843976 7:114386119-114386141 GACTCCCATCCCTCTGGATCCGG - Intronic
1031250871 7:119378914-119378936 GACTTCCACCCCTCTGGATCCGG - Intergenic
1031299578 7:120047506-120047528 GCCTTCCATCCCTCCAGATCCGG + Intergenic
1031718329 7:125135977-125135999 GACTTCCCAGCCTCCAGACCTGG + Intergenic
1031742821 7:125455903-125455925 GACTTCCATCCCTCCGGATCCGG - Intergenic
1032425787 7:131821162-131821184 GACTCCCACCCCTCTGGATCCGG - Intergenic
1032653848 7:133906726-133906748 GACTTCCATCCCTCCAGATCCGG + Intronic
1032725346 7:134585839-134585861 GACTTCCACCTCTCTGGATCAGG + Intergenic
1034248772 7:149671737-149671759 GACTTCCACCCCTCTGGATCTGG + Intergenic
1034650839 7:152688825-152688847 GACTTCCATCCCTCCGGATCCGG - Intergenic
1034707073 7:153155168-153155190 GACTTCCACCCCTCTGGATTTGG - Intergenic
1034924749 7:155112018-155112040 AACTTCCTCCTCTCCTGATCAGG - Intergenic
1036047441 8:5159728-5159750 GACTTCAATCTCTCCACATCAGG - Intergenic
1036687571 8:10922113-10922135 GACTTCCCAGCCTCCAGAACTGG + Intronic
1037570608 8:20154876-20154898 GACTTCCACCCCTCCAGATCTGG + Intronic
1038220516 8:25602852-25602874 GAGCTCCACACCTGCAGATCTGG + Intergenic
1038742246 8:30225906-30225928 GACTTCCATCCCTCTGGATCCGG - Intergenic
1038864139 8:31420893-31420915 GACTTCCCAGCCTCCAGAACTGG + Intergenic
1040498347 8:47986536-47986558 GACTTCCCAGCCTCCAGAACTGG - Intergenic
1040575955 8:48651747-48651769 AACCCCCACCCCTCCAGAGCAGG + Intergenic
1040975375 8:53188179-53188201 GACTTTCACCACTCTAGATACGG - Intergenic
1041095322 8:54343700-54343722 GGCTTCCATCCCACCAGAGCTGG + Intergenic
1041664089 8:60425336-60425358 GACTTCCACCCCTCGGGATCCGG - Intergenic
1042292932 8:67188695-67188717 GACTTCCACCCCTCCGGATCTGG + Intronic
1044625922 8:94235016-94235038 TACTTCCAGCCCTCCAAGTCTGG + Intergenic
1044988287 8:97774161-97774183 GACTTCCACCCCTCTGGATCCGG - Intergenic
1045657594 8:104403156-104403178 GACTTCCATCTCTCCAGATCTGG + Intronic
1045788634 8:105955518-105955540 GACTCCTATCCCTCCAGATCTGG - Intergenic
1045863511 8:106839354-106839376 GACTCCCACCCCTCAGGATCCGG - Intergenic
1047019168 8:120756490-120756512 ACCTTCTACCCATCCAGATCAGG - Intronic
1047276657 8:123410803-123410825 GACTTCTATCCCTCCAGATCCGG + Intronic
1047443556 8:124900105-124900127 GACTTTCACCCCTCTGGATCTGG - Intergenic
1047444443 8:124906784-124906806 GACTTTCACCCCTCCAGATCTGG - Intergenic
1047599741 8:126413930-126413952 GACTTCCACCCCTCCAGATCCGG - Intergenic
1047618317 8:126581363-126581385 GACTTCCACCCCTCCGGATCTGG + Intergenic
1047851126 8:128858746-128858768 GACTTCCCAGCCTCCAGAACTGG + Intergenic
1048100253 8:131343190-131343212 GACTTCCACCCTTCTGGATCCGG - Intergenic
1048631497 8:136247687-136247709 GACTTCCACCCCTCTGGATCTGG + Intergenic
1049287100 8:141781780-141781802 GACTTCCACCCTGCCAGGGCAGG - Intergenic
1050116054 9:2264565-2264587 GACTTCCACCCCTCCGGATCCGG - Intergenic
1050593505 9:7183583-7183605 GACTTCCATCCCTCTGGATCAGG + Intergenic
1051278901 9:15422395-15422417 CACGACCAGCCCTCCAGATCTGG - Intergenic
1051870080 9:21727303-21727325 GACTTCCATCCCTTCAGATCCGG + Intergenic
1052784072 9:32812502-32812524 GACATCCACTCCTCCCCATCAGG + Intergenic
1052988648 9:34505813-34505835 GCCTTCCACCTCTCCAGCTTCGG + Intronic
1053134330 9:35640625-35640647 GACTCCCATCCCTCCAGATCCGG - Intronic
1053215197 9:36265051-36265073 GACTTCCACCCCTCCGGATCTGG + Intronic
1055049591 9:71964996-71965018 GACTTCCATCCCTCTGGATCCGG - Intronic
1055431338 9:76247182-76247204 GACTTCCATCCCTCCAGATCAGG - Intronic
1055455701 9:76469647-76469669 GACTTCCATCCCTCTGGATCAGG + Intronic
1055789835 9:79911921-79911943 GACTTCCCCACCTCCGGATCAGG - Intergenic
1056705008 9:88944241-88944263 GACTTCCATCCCTCTGGATCTGG - Intergenic
1057465229 9:95307904-95307926 GACTTCCCAGCCTCCAGAACTGG - Intronic
1058740630 9:107938958-107938980 GAAGTCCACAGCTCCAGATCGGG + Intergenic
1060735880 9:126066345-126066367 GGCTTCCACGCCTCCAACTCTGG + Intergenic
1061079891 9:128363662-128363684 GACTTCCAGCCCTCTACATGTGG - Intergenic
1062716111 9:138011051-138011073 TACTCCCACGCCTCCAGACCTGG + Intronic
1185560917 X:1060114-1060136 GAGTTCCACCCCTCCGGATCAGG + Intergenic
1186254531 X:7703885-7703907 GACTTCCATCCCTCTGGATCCGG - Intergenic
1189649643 X:43175761-43175783 GACTTCCCAGCCTCCAGAACTGG - Intergenic
1189954271 X:46261961-46261983 GACTTCCATCCCTCCGGATCTGG - Intergenic
1190240565 X:48654942-48654964 GACTTCCATCCCTCCAGATCCGG + Intergenic
1191167481 X:57405520-57405542 TACTTCCACCACTCTGGATCTGG - Intronic
1192252501 X:69424209-69424231 GACTTCCTAACCTCCAGAACTGG + Intergenic
1192254880 X:69448019-69448041 GACTTCCACCCCTCCAGATCTGG + Intergenic
1192571979 X:72213580-72213602 GACTTCCACCCCTCCAGATATGG + Intronic
1192803104 X:74485844-74485866 GACTTCCACCCCTCCGGATCCGG - Intronic
1193295489 X:79827528-79827550 GACTTCCATCCCTCCGGATATGG - Intergenic
1194154500 X:90370260-90370282 GACTTCCATCTCTCTGGATCCGG - Intergenic
1194200899 X:90951886-90951908 GACTTCCATCCGTACAGATCAGG - Intergenic
1194445395 X:93981452-93981474 GACTTCCATCACTCCGGATCCGG - Intergenic
1194641952 X:96413216-96413238 GACTTCCTAGCCTCCAGAACTGG - Intergenic
1195505077 X:105647195-105647217 GGCTTCCACCCCTCCGGATCTGG - Intronic
1195584609 X:106551431-106551453 GACTTCCATCCCTCTGGATCTGG + Intergenic
1196258165 X:113547163-113547185 GACTTCCATCGCTCCGGATCCGG - Intergenic
1197545322 X:127816564-127816586 GACTTCCATCCCTCCGGATCCGG - Intergenic
1197750047 X:129957779-129957801 GACTACCACCCCACCAGGGCGGG - Intergenic
1197999712 X:132420307-132420329 GACTTCCACCCCTCCAGATCCGG - Intronic
1198381831 X:136091255-136091277 GACTTCCTAGCCTCCAGAACTGG - Intergenic
1198566835 X:137913871-137913893 GACTTCCATCCCTCCAGATCCGG - Intergenic
1198870797 X:141176115-141176137 GACTACCACCTTTCGAGATCAGG - Exonic
1199268781 X:145858465-145858487 GACTTCCATCCCTCCAGATACGG - Intergenic
1199368812 X:147020943-147020965 GACTCCCATCCCTCCAGATCCGG + Intergenic
1199536306 X:148906811-148906833 GACTTCCACCCCTCCGGATCCGG + Intronic
1200325985 X:155239923-155239945 GACTTCCCAGCCTCCAGAACTGG - Intergenic
1200500853 Y:3947153-3947175 GACTTCCATCTCTCTGGATCCGG - Intergenic
1200546750 Y:4527344-4527366 GACTTCCATCCGTCCAGATGAGG - Intergenic
1200762687 Y:7054624-7054646 GACTTCCATCCCTCCAGATCTGG + Intronic
1201329235 Y:12800043-12800065 GACTTCCACCCCTCCAGATCTGG + Intronic
1201642241 Y:16192161-16192183 GACTTCCACCCCTCCAGATCTGG - Intergenic
1201660574 Y:16393160-16393182 GACTTCCACCCCTCCAGATCTGG + Intergenic
1201723817 Y:17132997-17133019 GACTTCCAACCCTCTGAATCTGG - Intergenic
1202062376 Y:20900863-20900885 GACTTCCATCCCTCCAGATCTGG + Intergenic