ID: 1037571497

View in Genome Browser
Species Human (GRCh38)
Location 8:20161849-20161871
Sequence GCTGCTGGGTAGACTCAGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2061
Summary {0: 1, 1: 0, 2: 0, 3: 81, 4: 1979}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037571497_1037571503 7 Left 1037571497 8:20161849-20161871 CCGGGCTGAGTCTACCCAGCAGC 0: 1
1: 0
2: 0
3: 81
4: 1979
Right 1037571503 8:20161879-20161901 GGTTGGAGTCTTGTGCTTGCAGG No data
1037571497_1037571500 -10 Left 1037571497 8:20161849-20161871 CCGGGCTGAGTCTACCCAGCAGC 0: 1
1: 0
2: 0
3: 81
4: 1979
Right 1037571500 8:20161862-20161884 ACCCAGCAGCAATCATGGGTTGG No data
1037571497_1037571504 19 Left 1037571497 8:20161849-20161871 CCGGGCTGAGTCTACCCAGCAGC 0: 1
1: 0
2: 0
3: 81
4: 1979
Right 1037571504 8:20161891-20161913 GTGCTTGCAGGCCACCATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037571497 Original CRISPR GCTGCTGGGTAGACTCAGCC CGG (reversed) Intronic
Too many off-targets to display for this crispr