ID: 1037571710

View in Genome Browser
Species Human (GRCh38)
Location 8:20163558-20163580
Sequence TCAAAGGTGTTGGGAGCCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 184}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037571710_1037571716 12 Left 1037571710 8:20163558-20163580 CCTTTGGCTCCCAACACCTTTGA 0: 1
1: 0
2: 1
3: 12
4: 184
Right 1037571716 8:20163593-20163615 ATGTACAGCAGCGATTTTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037571710 Original CRISPR TCAAAGGTGTTGGGAGCCAA AGG (reversed) Intronic
901072968 1:6532249-6532271 TCAAAGTTGCTGGCAGCCAGAGG + Intronic
902610273 1:17593044-17593066 TCAAAGGGCCTGGGATCCAAAGG - Intronic
903665776 1:25006611-25006633 TCATAAATGCTGGGAGCCAACGG + Intergenic
903668807 1:25023522-25023544 GCAAAGCTGTTGGGATTCAATGG - Intergenic
903916329 1:26767193-26767215 TCAAAAGGGCTGGGAGCCAGAGG - Intronic
905281054 1:36849712-36849734 TCAAAGGTGCAGAGAGCCCATGG + Intronic
906033413 1:42736961-42736983 GCAGAGGTGTTGAGAGGCAAGGG - Intronic
906749730 1:48248094-48248116 CCGAAGGGGTGGGGAGCCAAGGG + Exonic
907675654 1:56515586-56515608 AGAAAGGAGTAGGGAGCCAAGGG + Intronic
910558391 1:88562808-88562830 TAAAAGGATTTGGGAGGCAAGGG - Intergenic
910930561 1:92439191-92439213 TCAAAGATTTGGGGAGCTAATGG - Intergenic
913461283 1:119088575-119088597 TCCAAACTGCTGGGAGCCAAAGG - Intronic
917154379 1:171980602-171980624 TGAGAAGTGTTGGGAGGCAAAGG - Intronic
1065342801 10:24723110-24723132 TCAAAGGTGCTAGGAGCCCCGGG + Intronic
1066461791 10:35619031-35619053 TCAAAGCAGTGGGGAGCCACAGG - Intergenic
1066687436 10:37994166-37994188 TTAAGGGAGTTGGGAGGCAATGG + Intergenic
1068911355 10:62381635-62381657 TCTGAGGTGTTGGGAGGCAGGGG + Intronic
1069825097 10:71250088-71250110 GCAGAGGTGCTGGGAGCCCATGG + Intronic
1071269550 10:83994217-83994239 TTGAAGGTGTGGAGAGCCAAAGG - Intergenic
1071345796 10:84691206-84691228 TGGAAGGTGTTGAAAGCCAAGGG + Intergenic
1074653220 10:115548921-115548943 CCAAAAGGGTTGGGAACCAAAGG + Intronic
1078136464 11:8656054-8656076 ACAAAGGTGTTGTGACACAAAGG - Intronic
1078513428 11:12003580-12003602 TCACAGCTGATGGGACCCAAAGG + Intronic
1078630780 11:13001808-13001830 TCAAAAATGTTGGGGGCCACTGG + Intergenic
1079099963 11:17534966-17534988 TCAGAGGTGGTGGGTGCGAAAGG - Intronic
1083600271 11:63943006-63943028 TCAAAGGTGCTGGAGGGCAAGGG - Intronic
1084095697 11:66909694-66909716 CCAAGTGTGGTGGGAGCCAAAGG + Intronic
1085426838 11:76412288-76412310 TCAAGTGTTTTGGGAGCCAGAGG + Intronic
1087444582 11:98233924-98233946 GCAAAGGTGTAGGGAGCCAAGGG + Intergenic
1088156484 11:106810462-106810484 TCACAGGTGATGGAAGTCAAAGG - Exonic
1089580489 11:119478902-119478924 GCAAAGGTGCTGGGAGGCAGGGG - Intergenic
1092861088 12:12719231-12719253 TAAAACGTGTTGGGAGCAATAGG + Intronic
1094201320 12:27797413-27797435 TCAAAGGTGTGGGGATACCAGGG + Intronic
1094346055 12:29470379-29470401 ACACAGGGGTTGGGAGACAAGGG - Intronic
1096280247 12:50246458-50246480 TGAAAGCTGTTGGGGGTCAAGGG - Intronic
1101018433 12:100526826-100526848 TCAAAGGTGTTGGAGGTGAAGGG - Intronic
1101190017 12:102322918-102322940 AAAAAGGTGTTGAGAGTCAAAGG - Intergenic
1101989845 12:109476025-109476047 GCAAAGGAGTTGGGAGTCAGAGG - Intronic
1102814902 12:115857957-115857979 GCAAAGCAGATGGGAGCCAATGG - Intergenic
1105624382 13:22098896-22098918 TCAATGATGTTGGCAGACAAGGG - Intergenic
1105818893 13:24062442-24062464 TGCACGGTGCTGGGAGCCAAGGG + Intronic
1105986677 13:25574036-25574058 TCACATGTATTGGGTGCCAAAGG + Intronic
1107559345 13:41546022-41546044 TCAATGGTGCAGGGAGCCGAGGG - Intergenic
1107711160 13:43151772-43151794 TCATAGATGTTGGGAGAGAAAGG + Intergenic
1108750658 13:53445115-53445137 TCAAGGAGGCTGGGAGCCAAGGG - Intergenic
1114350152 14:21841481-21841503 TCACAGGGGTTTGGAGCCAACGG + Intergenic
1114526957 14:23372413-23372435 ACAAAGGGGATGGGAGTCAAAGG + Intergenic
1115495650 14:34001921-34001943 TCAAAGCCATTGGGAGCCATTGG + Intronic
1116889178 14:50250367-50250389 CCAAAGGTGGTGGTAGCCACAGG + Intronic
1117263893 14:54065643-54065665 CCATAGGTGTTTGGAGTCAAGGG + Intergenic
1119588908 14:75866375-75866397 TCTAAAGTGTAGGGAGCCATTGG + Intronic
1121467532 14:94125752-94125774 CTAATGGTGGTGGGAGCCAAGGG + Intergenic
1122111900 14:99509091-99509113 TCAAACGGGTTGTGTGCCAATGG + Exonic
1122624848 14:103079307-103079329 TCCAAGGTGTTGGTAGGCAGGGG - Intergenic
1123121260 14:105918111-105918133 ACAGAGGTGCTGGGAGCAAATGG + Intronic
1123403987 15:20009775-20009797 ACAGAGGTGCTGGGAGCAAATGG + Intergenic
1123513327 15:21016421-21016443 ACAGAGGTGCTGGGAGCAAATGG + Intergenic
1126359092 15:47827140-47827162 TCAAAGGTGTTTTGAGCCCATGG - Intergenic
1129363006 15:75036292-75036314 CAAAAGGTCCTGGGAGCCAAGGG - Intronic
1132523897 16:404885-404907 TCCAAAGTGCTGGGAGCCACCGG + Intronic
1135523135 16:23192626-23192648 TGATAGGTCTTGGGAGCAAAAGG + Intronic
1137934036 16:52616894-52616916 TCCAAGGGGATGGGAGCCAATGG - Intergenic
1138567674 16:57845490-57845512 GCAAAGGTGTTGGGAGGGATAGG - Intronic
1139329313 16:66175256-66175278 TCAAGGCTGTTGGGAGTCAGGGG + Intergenic
1139703536 16:68724845-68724867 CCAAAGATGTTTGGAGACAAAGG - Intergenic
1139940869 16:70604527-70604549 TCAAATGTGTTGGCAGACAGAGG - Intronic
1140956856 16:79874368-79874390 TCACAGGAGCTGTGAGCCAAGGG - Intergenic
1143733641 17:8895456-8895478 GCAGAGGGGTTGGAAGCCAATGG - Intronic
1144032102 17:11332458-11332480 TCAAAAGTTTTGGGAGCCCATGG - Intronic
1152118143 17:78401365-78401387 TCAAGGGAGCTGGGAGCCACAGG - Intronic
1157353926 18:46916776-46916798 TCGAAGATGTTAGGAGGCAAGGG + Intronic
1157883207 18:51341687-51341709 TTAAAGGTGCTCGGAGACAAAGG + Intergenic
1161507018 19:4649575-4649597 TCAAGGGCGTTGAGAGCCAGTGG + Intronic
1165510368 19:36263359-36263381 TAAAAGGTGGCTGGAGCCAAAGG - Intergenic
926053568 2:9760303-9760325 TCAAAGGAGAAGGTAGCCAAGGG + Intergenic
926188889 2:10712509-10712531 TGAAAGAAGTTGGGAGCCAGAGG + Intergenic
926574531 2:14565602-14565624 TCAATGCTGTTGGGAGCCTGAGG - Intergenic
927332331 2:21880224-21880246 ACAAAGGGATTGGGAGGCAAAGG - Intergenic
930851550 2:55966412-55966434 TCAAATGTGTTGGGAGTCAGTGG + Intergenic
931625723 2:64254367-64254389 AAAAAGGTGGCGGGAGCCAAAGG + Intergenic
931653542 2:64489733-64489755 TCAGAGGGGTTGGGTCCCAAAGG + Intergenic
935008675 2:99109252-99109274 TCAAAGGGGTTGAGAGACAGAGG - Intronic
936635461 2:114251353-114251375 ACCAAGGTGTTGGAAGGCAATGG + Intergenic
937244738 2:120485313-120485335 TGAGAGGTCTTGGCAGCCAAAGG + Intergenic
937625560 2:124039464-124039486 TCACAGATGTTGGGAGACAGAGG - Intronic
938709071 2:133959833-133959855 TCAAAGGTGTTGGGAGGGTGGGG - Intergenic
941858701 2:170255489-170255511 TCACAGGTGTTGGGTGCTGAAGG - Intronic
942086643 2:172450010-172450032 TCAAGAGTGTTCGGAACCAAAGG + Intronic
942094799 2:172526654-172526676 TCAAAGATGATAGGGGCCAATGG - Intergenic
942151289 2:173077843-173077865 TCAAAGATCTTGGGAACTAAGGG + Intronic
942413629 2:175736455-175736477 TCAAAGCTGATGGGAGACACTGG - Intergenic
943062894 2:183057153-183057175 CCAAAGGTCTTGGCAGCCAGAGG - Intergenic
944725591 2:202468057-202468079 TCAAAGTTGTTGGGAGTGAGAGG + Intronic
946137194 2:217657101-217657123 TCAAAGGTGTGTGGAGACATGGG - Intronic
1168816818 20:743414-743436 TCAAAAGTGGTGGGAGCCATTGG - Intergenic
1170403108 20:16008964-16008986 TCAAAGATGTTGGCAGCAACAGG - Intronic
1172026086 20:31949796-31949818 TGAAAGGTCTTGGGGGCTAAGGG - Intronic
1172752340 20:37259552-37259574 TGGAAGGAGTGGGGAGCCAAGGG - Intronic
1175941745 20:62540550-62540572 ACCAAGGTGCTGGGAGCCCAGGG + Intergenic
1176249747 20:64114879-64114901 GCAGAGGTGCTGGGAGCAAAGGG - Intergenic
1176971790 21:15274877-15274899 TCTAAGGAATTGGGAGCCCAGGG + Intergenic
1181793899 22:25289689-25289711 TCAAGGGTGGTGGGAGACACAGG + Intergenic
1181833897 22:25586232-25586254 TCAAGGGTGGTGGGAGACACAGG + Intronic
1183478545 22:38050483-38050505 TGAAAGCTGGTGGGAGCCCAGGG - Intergenic
949190447 3:1243687-1243709 TAAAAGGTGGCTGGAGCCAAAGG - Intronic
955975040 3:64471770-64471792 TCACAGGTCATGGGAGTCAATGG - Intergenic
957864441 3:86003972-86003994 TCATAGGTACTTGGAGCCAATGG + Intronic
959005025 3:101010241-101010263 TGAAAGCTGTTGTGAGCAAATGG - Intergenic
966314604 3:178631694-178631716 TAAAAGGTGTTGGGAGAAAATGG + Intronic
968065104 3:195754139-195754161 TCAAGGGTGTAGACAGCCAAAGG - Intronic
969348190 4:6582106-6582128 TCAGAGGTGCTGAGAGGCAAAGG + Intronic
971123237 4:23725898-23725920 TAAAAGGTGGCTGGAGCCAAAGG - Intergenic
973991405 4:56412185-56412207 ACGAAGGAGTTTGGAGCCAAGGG - Intronic
974981362 4:68961155-68961177 TCAAAGGTGGGGTGAACCAAAGG + Intergenic
976155772 4:82143233-82143255 TCAAATCTGTAGGCAGCCAAAGG - Intergenic
979805921 4:124971016-124971038 TCAAAGGTGTTTGAAGACAATGG + Intergenic
980379490 4:131993282-131993304 TCTAGTGTGATGGGAGCCAAGGG - Intergenic
983726781 4:170939375-170939397 AAACAGGAGTTGGGAGCCAATGG - Intergenic
984560909 4:181268809-181268831 TCAAAACTGTTTGGAGTCAAAGG + Intergenic
984623677 4:181981088-181981110 TTAAAAGTGTTGGGAACCACAGG - Intergenic
987502623 5:18733023-18733045 TCATAGGTGAGGGGAGCCAGTGG - Intergenic
988252542 5:28778505-28778527 TCAAAGGGGTTGAGAATCAAAGG + Intergenic
989419075 5:41214754-41214776 TTCAAGGTGTTTGGAGCTAAAGG + Intronic
993128023 5:83859216-83859238 TAAAAGGTGTTGGAAGGAAAGGG + Intergenic
993175668 5:84482141-84482163 TCAAAGGTCTCTGGAGCAAAGGG - Intergenic
994992835 5:107019308-107019330 TCAAATGTGTTGGAAGTTAAAGG - Intergenic
997920911 5:137978584-137978606 AAAAAGGTGGTGGGAGGCAAAGG - Intronic
1000017099 5:157287709-157287731 TCAAAGGTCTATGGAGCCACAGG - Intronic
1001371600 5:171209877-171209899 TTAAAAGTGTTAGGAGACAAGGG - Intronic
1003070713 6:2943532-2943554 TAAAAGGTGATGGGCGGCAAAGG - Intergenic
1003205420 6:4005373-4005395 ACAAAGGGGTTGGGAGCAGATGG + Intergenic
1006791497 6:36704134-36704156 CCAAGGGTGATGGGAGCCAGGGG + Intronic
1007396920 6:41583225-41583247 CGAGAGGTGTTGGGAGCCATGGG + Intronic
1009335084 6:62477841-62477863 TCAGTGGTGTTGGGAGAAAATGG - Intergenic
1010494665 6:76519002-76519024 TCAAAGGTCTTGGTTCCCAAGGG + Intergenic
1012359693 6:98361786-98361808 TCAGAGGGGTAGGGAACCAAGGG + Intergenic
1013361326 6:109396330-109396352 GCAAAGGTGATGGGGGCCATGGG - Intronic
1015271320 6:131340705-131340727 AAAAAGGTGTCTGGAGCCAAAGG + Intergenic
1015977986 6:138810799-138810821 TCAAAGGTATTTGGATCAAAGGG + Intronic
1016737429 6:147494469-147494491 CCACATGTGTTGGGAGCCACTGG - Intergenic
1017599029 6:156060801-156060823 TCAAGGGTGTTGTGAGGAAAGGG + Intergenic
1019840925 7:3442877-3442899 TCAAAAGTGTTCGGAGGGAATGG - Intronic
1019996194 7:4725821-4725843 TCAGAGGGGTAGGGAGCCAGGGG + Intronic
1022580621 7:31549780-31549802 TCAAAGGTGCTGGGATCTATGGG + Intronic
1022646163 7:32230268-32230290 GCCAAGGTGATAGGAGCCAAGGG + Intronic
1022799158 7:33759192-33759214 TCTAAGGTGTTGGGTGCCATTGG - Intergenic
1023121083 7:36909501-36909523 TCAAAGATTTTAGGAGCAAAAGG + Intronic
1024211874 7:47213071-47213093 TCAAAGGTGTTGGGTTCCCCTGG - Intergenic
1024802509 7:53097076-53097098 ACAAATTTGATGGGAGCCAATGG + Intergenic
1026340044 7:69427210-69427232 TAAAAGGTGATGGCAGGCAATGG - Intergenic
1026850152 7:73719022-73719044 CCACAGGTGATGGGAGCCACAGG + Intronic
1026853270 7:73737816-73737838 TCAAAGGTGTGGAGAGCCTGGGG + Intronic
1028706775 7:93858192-93858214 ACAAAGGACTTGGGAGTCAATGG + Intronic
1029616621 7:101663250-101663272 TCATAGGTGTTGGGGGAGAAGGG + Intergenic
1033211463 7:139463078-139463100 TAAAAGGTGGCTGGAGCCAAAGG + Intronic
1034682580 7:152940327-152940349 TGAGAGGTGGTGGCAGCCAAGGG + Intergenic
1035357252 7:158283636-158283658 TCAACGGTGTTGGCCGCCAATGG + Intronic
1036778097 8:11627527-11627549 ACAAAGCTGCTGGGAGCAAAGGG + Intergenic
1037571710 8:20163558-20163580 TCAAAGGTGTTGGGAGCCAAAGG - Intronic
1037967749 8:23146926-23146948 TGAAAGCTGTTGGGAGCCCCTGG + Intronic
1038955775 8:32466998-32467020 GTAAAGGTGATGGGAGTCAATGG - Intronic
1040616731 8:49044967-49044989 TCAGAGATGTTGGGAGACCAAGG - Intergenic
1040793274 8:51258787-51258809 TCAAAGATATTGGGGGGCAAAGG + Intergenic
1042201401 8:66282261-66282283 CCAAAGGTAATGGGAGCCACTGG - Intergenic
1042445253 8:68876922-68876944 TCAAAGGTAATGGAAGCTAATGG + Intergenic
1043353725 8:79389985-79390007 AAAAAGGTGGTTGGAGCCAAAGG - Intergenic
1048582156 8:135738406-135738428 GCAAAGGCTTTGGGAGGCAAAGG - Intergenic
1048894109 8:138973798-138973820 GCAAAGGTGTTGGGATGCACAGG + Intergenic
1051692721 9:19733417-19733439 TTAAAGGTGTGAGGAGGCAATGG - Intronic
1054172738 9:61856126-61856148 TCAAAGGAGGTGGGAGGCAGAGG + Intergenic
1054664802 9:67724675-67724697 TCAAAGGAGGTGGGAGGCAGAGG - Intergenic
1054705765 9:68460457-68460479 TCAAAGGTTTGAGGAGCAAAAGG - Intronic
1055250010 9:74292824-74292846 TCCAAGGTGCTGGGAGCCACAGG - Intergenic
1056868107 9:90249261-90249283 CTATAGGTGTTTGGAGCCAAGGG + Intergenic
1056869992 9:90268238-90268260 ACAAAGATTTTGGGAGGCAATGG + Intergenic
1057577806 9:96257401-96257423 CTAAAGGTGGTGGGAGCCTAGGG - Intronic
1058139150 9:101339751-101339773 TGTAAGGTATTAGGAGCCAAGGG + Intergenic
1059500401 9:114747887-114747909 TCCAAGGTGTTAGGAGACTAAGG - Intergenic
1060266642 9:122115530-122115552 TTAAAGGAGGTGGGAGCCACAGG - Intergenic
1061370336 9:130194138-130194160 TCAAACATGGTGGGAGCAAAAGG - Intronic
1061765178 9:132877455-132877477 TCAAAGGTTCTGAGAGGCAAGGG - Intronic
1062164475 9:135100393-135100415 TCAATGGTGTTAGCAGCCCAAGG - Intronic
1062243450 9:135551711-135551733 TCAATGCTGTTGGGAGCCCCAGG + Intergenic
1186112253 X:6270765-6270787 TCATAGATGTTGGTATCCAAGGG + Intergenic
1189128503 X:38474258-38474280 GCAAAGGTGGTGGGGGCAAAAGG + Intronic
1190853950 X:54274713-54274735 TCAAAGATGATGGGAGCTGATGG + Intronic
1190869678 X:54414566-54414588 TAAAAGGTTTTTGGAGCAAATGG + Intergenic
1191205844 X:57833518-57833540 GCAAAGGTGTTGGGAGGATAAGG + Intergenic
1192056566 X:67779826-67779848 ACTAAGGAGTTGGGAGCCAGAGG + Intergenic
1194732192 X:97468220-97468242 TCATAGGTGATGGTGGCCAAAGG - Intronic
1196095369 X:111792670-111792692 TCAAAGGTCTTGGTTCCCAAAGG + Intronic
1197174533 X:123471252-123471274 TCAATGGTTTTGGCAGCCATTGG - Intronic
1198042908 X:132872023-132872045 AAAAAGGTGTTGGAAGGCAAGGG - Intronic
1198102755 X:133436281-133436303 TTAAGAGTGATGGGAGCCAAAGG + Intergenic
1198982599 X:142416432-142416454 TCAAAGGTAGAGTGAGCCAAAGG + Intergenic
1199575678 X:149311726-149311748 TCCATCTTGTTGGGAGCCAATGG - Intergenic
1200532892 Y:4359274-4359296 AAAAAGGTGGTTGGAGCCAAAGG - Intergenic
1201455123 Y:14160956-14160978 TCAAAAGTGTTGGGAGACAGGGG - Intergenic