ID: 1037573092

View in Genome Browser
Species Human (GRCh38)
Location 8:20175211-20175233
Sequence ATGGAGATGTTCAGGGAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 454
Summary {0: 1, 1: 1, 2: 4, 3: 39, 4: 409}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037573092_1037573096 -2 Left 1037573092 8:20175211-20175233 CCTTGCTCCCTGAACATCTCCAT 0: 1
1: 1
2: 4
3: 39
4: 409
Right 1037573096 8:20175232-20175254 ATTATCCTATTCTTTTTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037573092 Original CRISPR ATGGAGATGTTCAGGGAGCA AGG (reversed) Intronic
900790002 1:4673605-4673627 TTGGAGGTGTGGAGGGAGCAGGG + Intronic
900936171 1:5767526-5767548 AGAGCGATGTTCAGGGAACAAGG - Intergenic
902738766 1:18419619-18419641 ATGGAGATGTGCAGGCAGCTTGG - Intergenic
903495588 1:23764682-23764704 ATAGAGAAGTTCAGGGGGCCGGG - Intergenic
903890281 1:26565279-26565301 AAGGGGATGACCAGGGAGCAGGG + Intronic
904714617 1:32457968-32457990 ATGGTGATCTTCTGGGAGCAGGG + Intergenic
905820494 1:40986380-40986402 AGGGAGATGGTCAGAGAGCGGGG + Intronic
906577110 1:46901054-46901076 ATGGCGATTTTCAGGGAACAAGG + Intergenic
906577888 1:46907367-46907389 ATGGTGATTTTCAGGGAACAAGG + Intergenic
907456668 1:54580776-54580798 ATGGAGATGGTGAGGCTGCAGGG + Intronic
909125123 1:71658042-71658064 CTGGAGCTGTGCAGGGATCATGG - Intronic
909618898 1:77645456-77645478 ATGGTGATCTCCAGGGAGCAGGG + Intronic
910605563 1:89080042-89080064 ACAGCGATGTTCAGGGAACAAGG + Intergenic
911197990 1:95015215-95015237 ATGGAGATCTGCAGGGAGCTGGG + Intronic
911525162 1:98975413-98975435 TTGGAGATGTACAGGAAGCAGGG + Intronic
912058831 1:105639037-105639059 ATGGAAATGTTCATTGAGTATGG + Intergenic
912736451 1:112153308-112153330 AAAGAGATGTTCTGGGAACAGGG + Intergenic
913105058 1:115606605-115606627 ATGATGATCTCCAGGGAGCAGGG + Intergenic
915979251 1:160409903-160409925 ATGGTGATGATTAGGGAGCCAGG + Intronic
916145561 1:161735940-161735962 ATGGTGATCTCCTGGGAGCAGGG + Intergenic
916287292 1:163122345-163122367 AAGGAGCTGTTCAGGGAGAGAGG - Intronic
916869277 1:168894972-168894994 ATGGAGGTTTTCACTGAGCAAGG + Intergenic
917129231 1:171723589-171723611 ACAGCGATGTTCAGGGAACAAGG - Intronic
917373398 1:174320891-174320913 ACAGTGATGTTCAGGGAACAAGG + Intronic
917821191 1:178765900-178765922 ACAGCGATGTTCAGGGAACAAGG - Intronic
918067016 1:181108238-181108260 ATGGAGATGGTCGAGGAGCCTGG + Intergenic
918744411 1:188182048-188182070 AAAGCGATGTTCAGGGAACAAGG + Intergenic
919830408 1:201536894-201536916 ATGGACAGGTTGAGGGAGGAAGG - Intergenic
920062189 1:203234896-203234918 ACAGCGATGTTCAGGGAACAAGG + Intronic
920193805 1:204212943-204212965 GGGGAAATGTTCAGGAAGCAGGG - Intronic
920578208 1:207078843-207078865 ATGGGGAGGTTGAGGGAGGAGGG + Intronic
921195694 1:212755362-212755384 ATGGAGATGTTAATGGAAGATGG + Intronic
921590115 1:216993295-216993317 AGGGAGATGGTGAGGGAGGAGGG - Intronic
922361097 1:224822134-224822156 ACAGCGATGTTCAGGGAACAAGG - Intergenic
923276011 1:232396986-232397008 CTGGAGATTTTCAGGGAATAAGG - Intergenic
923419624 1:233799534-233799556 ACAGTGATGTTCAGGGAACAAGG - Intergenic
924271065 1:242333151-242333173 ATGGAGCTGTTCAGGCAGCAGGG + Intronic
924275835 1:242385956-242385978 ATGCAGAAGTTCAGGGACCAAGG + Intronic
924358920 1:243215289-243215311 ACAGCGATGTTCAGGGAACAAGG + Intronic
924505867 1:244683171-244683193 ATGGAGGTGATCAGATAGCAAGG + Intronic
924689307 1:246330252-246330274 ATGAAGATGTTCAGGTTACATGG - Intronic
1063501602 10:6560134-6560156 ATGGATATTTTCAAGGAGAAGGG - Intronic
1065349594 10:24783578-24783600 CAGGAGCTGTTCAGGAAGCATGG + Intergenic
1065512516 10:26493185-26493207 ACAGTGATGTTCAGGGAACAAGG - Intronic
1066658557 10:37718070-37718092 ATAGCGATTTTCAGGGAACAAGG + Intergenic
1066663947 10:37764027-37764049 ACAGTGATGTTCAGGGAACAAGG + Intergenic
1066713887 10:38265711-38265733 ATGGAGCTGTTCAGGGAGCAGGG - Intergenic
1067222477 10:44353878-44353900 ATGGAGATGGGTAGGCAGCAAGG + Intergenic
1067365293 10:45621919-45621941 ATGGAGATTGTCAGTGACCACGG + Intronic
1067461717 10:46463148-46463170 ACGGAATTGTTCAGGGAACATGG + Intronic
1067625477 10:47921453-47921475 ACGGAATTGTTCAGGGAACATGG - Intergenic
1067920025 10:50445762-50445784 ACAGCGATGTTCAGGGAACAAGG + Intronic
1069185300 10:65414778-65414800 ACAGAGATATTCAGGGAACAAGG - Intergenic
1070556219 10:77529708-77529730 CTGGAGAGGTTCTGGGATCAGGG - Intronic
1071183881 10:83018784-83018806 ACAGTGATGTTCAGGGAACAAGG + Intergenic
1071189322 10:83081680-83081702 ACAGCGATGTTCAGGGAACAAGG + Intergenic
1071195713 10:83156748-83156770 ATGATGATGTACATGGAGCAAGG + Intergenic
1071257704 10:83887658-83887680 ATGCAGATGTTCAAAGAGCTTGG - Intergenic
1071752553 10:88496893-88496915 ATGGAGATGGTCAAAGAGTAGGG + Intronic
1074235310 10:111578894-111578916 TTGAAGATGTTCATGAAGCAGGG + Intergenic
1076210127 10:128633800-128633822 AAGGAGATGTTTAGTAAGCAAGG + Intergenic
1077154081 11:1083793-1083815 CTCTCGATGTTCAGGGAGCAGGG - Intergenic
1077800727 11:5533390-5533412 ATGGCGATGTTGAGGCAGTAGGG - Intronic
1078839335 11:15063628-15063650 ACAGCGATGTTCAGGGAACAAGG - Intronic
1078840080 11:15070146-15070168 ACAGCGATGTTCAGGGAACAAGG - Intronic
1079829552 11:25245385-25245407 ACAGCGATGTTCAGGGAACAAGG - Intergenic
1081380576 11:42409641-42409663 ATGTAGAAGTGCAGGGATCAGGG - Intergenic
1082295617 11:50438462-50438484 ACAGTGATGTTCAGGGAACAAGG + Intergenic
1082809178 11:57468197-57468219 ATGGAGATGCTGAGGCAGGAAGG - Intronic
1083146371 11:60762736-60762758 GGGGAGATGTTGAGGGTGCACGG + Intronic
1083261218 11:61524131-61524153 AGGGCTATGTTCAGGGAACAGGG - Intronic
1084443781 11:69191518-69191540 AGGGAGATGTTCAGGGTGACTGG + Intergenic
1084583677 11:70040971-70040993 GTGGAGAGGTTCTGGGAGCTTGG + Intergenic
1084729944 11:71066374-71066396 AGGGAGATGAGCAGTGAGCAGGG + Intronic
1085959514 11:81443804-81443826 ACAGTGATGTTCAGGGAACAAGG - Intergenic
1087393991 11:97573582-97573604 ACAGCGATGTTCAGGGAACAAGG + Intergenic
1087410411 11:97784377-97784399 ATAGCGATGTTCAGGGAACAAGG + Intergenic
1088087856 11:106003071-106003093 ACAGCGATGTTCAGGGAACAAGG + Intronic
1088810613 11:113389095-113389117 AGGCAGATGTTGAGGGAGGAAGG - Intronic
1089179223 11:116569461-116569483 CTGGAGAGCTTCAGGGAGCAGGG + Intergenic
1089846942 11:121466115-121466137 TTGGAGCTGTTAAGGCAGCAGGG - Intronic
1091314644 11:134604949-134604971 CTGCAGATGTACAGGAAGCAGGG + Intergenic
1092517426 12:9229718-9229740 AAGGAAAGGTTCAGAGAGCAAGG - Intergenic
1092784974 12:12018426-12018448 AGGGAGAGGACCAGGGAGCAGGG - Intergenic
1092918562 12:13209988-13210010 TTGGAGACGGTCAGGGAGAATGG + Intronic
1093110324 12:15144257-15144279 ATGGAGATGCTCAGTGACCATGG + Intronic
1093347983 12:18063257-18063279 ACAGTGATGTTCAGGGAACAAGG - Intergenic
1093467282 12:19462695-19462717 ATGTAGATGGTCAGCGAGGAGGG + Exonic
1094368644 12:29711612-29711634 TTGGAGATGTTCAGGGATTTGGG + Intronic
1095097434 12:38155961-38155983 AGGGAGAGGTTGAGGCAGCATGG + Intergenic
1095251925 12:39989166-39989188 ATGGAGAGTTTCAGGGGGTAAGG - Intronic
1096574802 12:52545990-52546012 ATGGGGTTTTGCAGGGAGCAGGG + Intronic
1096605419 12:52761575-52761597 ACAGAGATGTTCAGGGAACAAGG - Intergenic
1096621689 12:52869413-52869435 CAGGAGATGGGCAGGGAGCAGGG + Intergenic
1096654526 12:53080134-53080156 ATGGTGATGGGAAGGGAGCAAGG - Intergenic
1096800893 12:54109821-54109843 CTGGAGATGTCCAGGGATGAAGG - Intergenic
1096943792 12:55381193-55381215 ACAGCGATGTTCAGGGAACAAGG - Intergenic
1096948810 12:55441625-55441647 ACAGTGATGTTCAGGGAACAAGG - Intergenic
1097354720 12:58588223-58588245 ATGGAGAAGGTCACAGAGCACGG + Intronic
1098021331 12:66159332-66159354 ATGGAGAGGTTCATGTGGCAAGG + Intronic
1098209606 12:68149673-68149695 GTTGAGATGTTCAGGCTGCATGG - Intergenic
1099224065 12:79948329-79948351 ATGGAGATGTCCACAGAGCAAGG + Intergenic
1099302770 12:80918505-80918527 AGGGAGATGAAAAGGGAGCAAGG - Intronic
1099480849 12:83164469-83164491 ATGGAGATGTACAAGGTGAATGG - Intergenic
1100181182 12:92088087-92088109 ATGGGAATGTTCAGGGTGCTAGG - Intronic
1100980470 12:100158630-100158652 ATGGTGACCTTCTGGGAGCAGGG - Intergenic
1101153647 12:101907305-101907327 GTAGAGATTATCAGGGAGCAGGG + Intronic
1101502096 12:105313746-105313768 ACAGTGATGTTCAGGGAACAAGG + Intronic
1102130850 12:110527761-110527783 AAGGAGAAGTTCAGGGTGCTTGG + Intronic
1102436360 12:112927047-112927069 ATAGCGATGTTCAGGGAACAAGG - Intronic
1103133927 12:118491393-118491415 TTGGAGATGTGAAGGGATCATGG - Intergenic
1104088338 12:125494623-125494645 ATGGCCATTTTCAGGGAGGAGGG - Intronic
1104500809 12:129283673-129283695 CTGCAGATGATTAGGGAGCAGGG + Intronic
1105362894 13:19737119-19737141 ATGGTGACCTTCTGGGAGCAGGG - Intronic
1106177249 13:27341918-27341940 ATGGAGCTGTACAGAGAGCCAGG + Intergenic
1106430422 13:29675671-29675693 AGGGAGATGTTTTAGGAGCAGGG + Intergenic
1107520527 13:41175985-41176007 ACAGTGATGTTCAGGGAACAAGG - Intergenic
1107654563 13:42578385-42578407 GAGGAGAGGTTCAGGGTGCAAGG - Intronic
1107964082 13:45584149-45584171 ATGGAGAATTTCTGTGAGCATGG + Intronic
1108902219 13:55425407-55425429 ACAGTGATGTTCAGGGAACAAGG - Intergenic
1109690015 13:65874511-65874533 ATGGAGATGTTCTGAGAGCATGG - Intergenic
1109911928 13:68923546-68923568 ACAGCGATGTTCAGGGAACAAGG - Intergenic
1110464050 13:75780490-75780512 ACAGCGATGTTCAGGGAACAAGG - Intronic
1110620172 13:77586010-77586032 ATGGAGAGTTTCAGGGAGGAGGG - Intronic
1112187856 13:97145148-97145170 TTGGAGTTGTTCAGGGACCCAGG - Intergenic
1112709913 13:102115682-102115704 GTGGAGAGGGTCAGGGAGCATGG + Intronic
1115307982 14:31951655-31951677 GTGGTAATGTTCAGGGAGCCTGG - Intergenic
1115958822 14:38811396-38811418 ACAGCGATGTTCAGGGAACAAGG - Intergenic
1117099882 14:52335301-52335323 ATTGAGTTGTTCAGAGAGGAGGG - Intergenic
1119405645 14:74397152-74397174 ATGGTGAGGTGCAGGGAGCTTGG + Intergenic
1120445532 14:84590461-84590483 ATGGAAATTTTCATGGAGCTGGG + Intergenic
1120807256 14:88766227-88766249 ACAGCGATGTTCAGGGAACAAGG + Intronic
1121099469 14:91240430-91240452 AAAGCGATGTTCAGGGAACAAGG - Intronic
1121343171 14:93116645-93116667 AAGGAGATTTTGATGGAGCAGGG + Intergenic
1121357934 14:93230959-93230981 ATGGAGATATTCTGGGGACAGGG + Intergenic
1121379883 14:93455337-93455359 ATGGAGATGTGGAGAGAACAAGG - Intronic
1121617471 14:95322261-95322283 AAGGTGAAGTGCAGGGAGCAGGG - Intergenic
1121642858 14:95497633-95497655 CTGGAGACGGTCAGAGAGCAAGG + Intergenic
1122828317 14:104383079-104383101 AAGCAGAGGCTCAGGGAGCAGGG - Intergenic
1123931614 15:25174541-25174563 ACAGCGATGTTCAGGGAACAAGG - Intergenic
1124530851 15:30504319-30504341 ATGGAGATATACTGGGAGCTCGG + Intergenic
1124710460 15:32005920-32005942 AAGGAGTTGTTTAGGGAGAATGG - Intergenic
1124767809 15:32503376-32503398 ATGGAGATATACTGGGAGCTCGG - Intergenic
1125324448 15:38522726-38522748 ATTGAGAAGTTCAGTGAGGAAGG + Intronic
1125587090 15:40828605-40828627 TGGGAGATGTGCAGGAAGCAGGG + Exonic
1127145990 15:56024627-56024649 ACAGTGATGTTCAGGGAACAAGG + Intergenic
1127671206 15:61197062-61197084 AGGGAGCTGTTCAGGCAGCAAGG + Intronic
1128354116 15:66912635-66912657 ATGGGGATGTGCAGGGGCCAGGG - Intergenic
1128841279 15:70853615-70853637 GTGGGGATGTTCAGGGATCCAGG - Intronic
1129592158 15:76926392-76926414 ATGCAAATGTACAGGGGGCATGG - Intergenic
1129981432 15:79874869-79874891 ACAGCGATGTTCAGGGAACAAGG - Intronic
1130410665 15:83645643-83645665 ATGGGGTGGTTCAGGGAGCCAGG + Intergenic
1130728432 15:86465431-86465453 ACAGAGATTTTCAGGGAACAAGG + Intronic
1136673817 16:31880957-31880979 ATGGAGGTGTACAGGGAACTTGG + Intronic
1137395626 16:48114690-48114712 AGGGAGATGGTCTGGAAGCAGGG + Intronic
1137783215 16:51115139-51115161 ATGGATAATTTCAGGGAGCCTGG - Intergenic
1138500477 16:57439930-57439952 ACAGCGATGTTCAGGGAACAAGG + Intronic
1140474620 16:75233682-75233704 ATGAAGATGGTCAGGAGGCAGGG + Intronic
1142249080 16:88982936-88982958 ATGGAGGCGTGCAGGGGGCATGG - Intergenic
1142767838 17:2075678-2075700 TTGGAGTTGTTCAGAGACCAGGG - Intronic
1143633073 17:8149810-8149832 GTGGACATGTCCATGGAGCAAGG + Exonic
1143870921 17:9956863-9956885 AAGGAGATGCTCAGGGCGAAAGG - Intronic
1144462442 17:15468960-15468982 ATGGAGATACTCAGGGCTCAGGG - Intronic
1145292399 17:21558897-21558919 ACAGCGATGTTCAGGGAACAAGG + Intronic
1145387561 17:22427009-22427031 ACAGCGATGTTCAGGGAACAAGG - Intergenic
1145834324 17:27942659-27942681 ATGCAGATGTCCATGGAGTAAGG + Intergenic
1145869517 17:28262092-28262114 ACAGCGATGTTCAGGGAACAAGG + Intergenic
1146170780 17:30631236-30631258 GTGGAGATGCTAAAGGAGCAGGG - Intergenic
1146344227 17:32047255-32047277 GTGGAGATGCTAAAGGAGCAGGG - Intronic
1146352015 17:32102934-32102956 TTGGTGATGTTCAGGGAGTGGGG + Intergenic
1146496292 17:33325429-33325451 ATGGAGATCTTGAGGCAGAAAGG + Intronic
1147976015 17:44248482-44248504 TTGGCCATGTTCAAGGAGCAAGG + Exonic
1148020406 17:44549466-44549488 ATGGACAGGTTCAGGGAGAGAGG + Intergenic
1148163297 17:45464166-45464188 AAGGAGAGGTGCAGGGAGTAGGG - Intronic
1149275520 17:55030468-55030490 ATGGAGATGTACAAGGGGCTGGG + Intronic
1149336009 17:55636869-55636891 ATGGAGAGGCCCAGGTAGCAAGG + Intergenic
1149698731 17:58637594-58637616 ATGGAGAGGTTCCTGGAGGATGG + Intronic
1150123786 17:62623584-62623606 ATGGGGATGTTCAGGGAATGTGG - Intergenic
1151724787 17:75877681-75877703 ATGGAGATGGGAAGGGAGGAAGG - Intronic
1152435592 17:80274356-80274378 CTGGACATGTTCAAGGAGAATGG + Intronic
1154371043 18:13763489-13763511 CAGGAGAAGTCCAGGGAGCAGGG - Exonic
1155740879 18:29286160-29286182 ATAGACATGTTGAGAGAGCAAGG - Intergenic
1156282236 18:35650753-35650775 ACAGTGATGTTCAGGGAACAAGG - Intronic
1157467624 18:47960982-47961004 ACAGCGATGTTCAGGGAACAAGG + Intergenic
1157619223 18:49006447-49006469 ATGGAGATGGTAAGGGTGGAGGG - Intergenic
1158055276 18:53271579-53271601 ATGGAGAGGTCCATGGAGCAAGG - Intronic
1158174630 18:54640912-54640934 ATGGACATCATCAGGGAACAGGG - Intergenic
1158483369 18:57842773-57842795 ATGAAGATGCTCAGGGAAGAAGG - Intergenic
1159280111 18:66274264-66274286 ACAGCGATGTTCAGGGAACAAGG + Intergenic
1160250513 18:77199795-77199817 ATTGAGATGTTCAGGCAACTGGG - Intergenic
1160774762 19:850379-850401 GTGGTGATGTTAAGGCAGCAAGG + Intergenic
1162126191 19:8500612-8500634 AGGGAAGTGTTCAGGGTGCAGGG - Intronic
1162843442 19:13372983-13373005 ATGGACATGTTCAGGAAACAGGG - Intronic
1163038274 19:14584226-14584248 ATGGTGATGTTTTGGGAGCAGGG + Intronic
1163038965 19:14588488-14588510 ATGGTGATGTTTTGGGAGCAGGG + Intronic
1164330608 19:24251120-24251142 AGAGAGATGTTCAGGGAACTAGG + Intergenic
1164439217 19:28259285-28259307 ATGCAGATGAACAGTGAGCACGG - Intergenic
1165652718 19:37505490-37505512 ATGGAGAGGCCCAGGTAGCAAGG - Intergenic
1166145328 19:40830620-40830642 ATGTAGAGGTGAAGGGAGCATGG - Intronic
925218292 2:2116394-2116416 ATTGAGATCTCCTGGGAGCAAGG - Intronic
925398541 2:3554921-3554943 ATGGGGATGTTAAGGGAGAATGG - Intronic
925595506 2:5551977-5551999 CTGGAGAGGGTGAGGGAGCAGGG + Intergenic
925784874 2:7422144-7422166 ATGGAGAGTGTGAGGGAGCAGGG + Intergenic
926859148 2:17290682-17290704 ATAGCAATGTTCAGGGAACAAGG - Intergenic
929747295 2:44672070-44672092 ATGGGGAGGGTCAGGGAGAATGG - Intronic
930405598 2:50951742-50951764 ATGCAGATGTTCAGGCATGAGGG - Intronic
930912144 2:56641815-56641837 GGGGAGAGGTTCAGGGAGAATGG + Intergenic
931599395 2:63988825-63988847 ACAGCGATGTTCAGGGAACAAGG + Intronic
931600327 2:63996508-63996530 ACAGCGATGTTCAGGGAACAAGG + Intronic
932177347 2:69614923-69614945 CTGGAGCTTTTGAGGGAGCACGG + Intronic
933459940 2:82569793-82569815 ACAGTGATGTTCAGGGAACAAGG + Intergenic
934141509 2:89051860-89051882 ATAGAGATGTTGAAGAAGCAGGG - Intergenic
934227733 2:90148683-90148705 ATAGAGATGTTGAAGAAGCAGGG + Intergenic
934919318 2:98330143-98330165 ATGGAGCTATTCAAGGTGCAGGG + Intergenic
934932175 2:98435610-98435632 ACAGTGATGTTCAGGGAACAAGG + Intergenic
935142143 2:100362663-100362685 ACAGCGATGTTCAGGGAACAAGG - Intergenic
936017438 2:108970494-108970516 GTGGAGATGGTCTGGGAGCTGGG + Intronic
936702912 2:115035255-115035277 ATGGAAGTGTACAGGGAGCTAGG - Intronic
937198643 2:120182169-120182191 AGGGAGATGGTCAGGGACCCGGG - Intergenic
937749727 2:125460826-125460848 ATAGAAATGTTCAGAAAGCAAGG - Intergenic
938858523 2:135341554-135341576 ACAGCGATGTTCAGGGAACAAGG + Intronic
939146868 2:138426055-138426077 ATAGCGATTTTCAGGGAACAAGG + Intergenic
939649920 2:144747543-144747565 ACAGTGATGTTCAGGGAACAAGG + Intergenic
941064972 2:160891740-160891762 GTGGTGCTGTTCAGGGAGGAGGG - Intergenic
941577003 2:167245423-167245445 ATGGAGATGTGCGAGGAACAAGG + Exonic
941862603 2:170299351-170299373 GTGGCAATGTCCAGGGAGCAAGG - Intronic
943502649 2:188711409-188711431 ACAGCGATGTTCAGGGAACAAGG + Intergenic
944151236 2:196561008-196561030 ACAGCGATGTTCAGGGAACAAGG + Intronic
945371061 2:209018572-209018594 ACAGCGATGTTCAGGGAACAAGG + Intergenic
946510232 2:220348132-220348154 TTGCAGTTGTTGAGGGAGCATGG + Intergenic
947270464 2:228328356-228328378 ACAGCGATGTTCAGGGAACAAGG - Intergenic
947451067 2:230209475-230209497 AAGGAGAGGATCAGGGAGGAAGG + Intronic
947806983 2:232975828-232975850 ATGGAGGTTTTCAGGGTACAAGG + Intronic
947881889 2:233523221-233523243 AGGAAGACGTTCAGGGAGCAAGG - Exonic
948769134 2:240239119-240239141 ATGGAGAAGGTCTGGGAGCCAGG - Intergenic
948973568 2:241448207-241448229 AGGGTGATGGTCAGGGAGCAGGG - Intronic
1169374263 20:5053889-5053911 ACAGCGATGTTCAGGGAACAAGG + Intergenic
1169745809 20:8941561-8941583 ATGGAGTTGCTAAGGGATCAAGG + Intronic
1170419004 20:16173862-16173884 TTGGAATTGTTTAGGGAGCAGGG + Intergenic
1171209047 20:23302904-23302926 ATGGAGAGGTTGAAGGAGAAGGG + Intergenic
1171339388 20:24415411-24415433 ACAGCGATGTTCAGGGAACAAGG + Intergenic
1171852666 20:30319617-30319639 CTGGAGATGTCCAGGGATGAAGG - Intergenic
1172591833 20:36123147-36123169 ATGGAGACGTTCAGAAAGCCTGG - Intronic
1173161036 20:40652878-40652900 CTGGGGATGTGCAGGGGGCAGGG - Intergenic
1173252417 20:41371184-41371206 AGGGAGATGGTCAGGGACAAAGG - Intergenic
1174203879 20:48825998-48826020 AAGGAGATGTACTGGGGGCAGGG - Intronic
1175169824 20:57072359-57072381 ATGGAGATGTTGAGGGCTTAGGG - Intergenic
1175571142 20:60023395-60023417 ATGGATGTGTTCAGGCGGCAGGG + Intronic
1176210283 20:63916933-63916955 ATCGTGATTTTCAGGGAACAAGG - Intronic
1176868988 21:14072131-14072153 AAGGTGATGTTGAGGCAGCACGG - Intergenic
1176869107 21:14072541-14072563 AAGGTGATGTTGAGGCAGCACGG - Intergenic
1176869207 21:14072932-14072954 AAGGGGATGTTGAGGCAGCACGG - Intergenic
1177911121 21:27033644-27033666 ATGGAGAGGTACATGCAGCAAGG + Intergenic
1178349473 21:31862219-31862241 TTGGAGAGGTTCAAGTAGCAAGG + Intergenic
1179026024 21:37679091-37679113 ATAGAGATGTCCACGTAGCAAGG + Intronic
1179585790 21:42373387-42373409 AAGGCGTTGTGCAGGGAGCAGGG + Intronic
1179879218 21:44286491-44286513 ATGGAGATGGGCAGGCCGCAGGG + Intronic
1181058131 22:20269324-20269346 AGGGAGATGAGCAGGGCGCAGGG + Intronic
1181110551 22:20600384-20600406 ATGTGGAGGTGCAGGGAGCAGGG + Intergenic
1181393451 22:22600646-22600668 CTGGTGATGGTCAGAGAGCATGG - Intergenic
1181429257 22:22867994-22868016 CTGGTGATGGTCAGAGAGCATGG - Intronic
1183910364 22:41074695-41074717 ATGGAGATCCTCACTGAGCACGG - Intergenic
1184432242 22:44448306-44448328 ATTCAGATGTCCACGGAGCATGG - Intergenic
1184466928 22:44674031-44674053 ATGAATATGTTTAGGGAGAAAGG - Intronic
1184480909 22:44746341-44746363 ATGGAGAATTTCAAGGAGGAGGG - Intronic
949511027 3:4767347-4767369 CTGGAGATATTCTGGGAGTAGGG - Intronic
950073315 3:10169611-10169633 ACAGTGATGTTCAGGGAACAAGG - Intronic
950773796 3:15332709-15332731 TTGGAGATGTGGAGGGAGCTGGG - Intronic
950947291 3:16962059-16962081 ATGGGGAAGCTCAGGGAGCATGG + Intronic
951045910 3:18038109-18038131 AGGGTCATGTTCAGGCAGCATGG + Intronic
951212199 3:19988143-19988165 ACAGCGATGTTCAGGGAACAAGG + Intronic
952274540 3:31864645-31864667 ATGGAGGTGTGCAGGGTGCTTGG + Intronic
952757422 3:36883674-36883696 ATGGAAATGGCCAGGGTGCAAGG + Intronic
952883236 3:37998254-37998276 ATGTAGAAGTCCTGGGAGCAAGG - Exonic
953038003 3:39229677-39229699 AAAGAGATGTAAAGGGAGCAAGG - Intergenic
953283953 3:41587211-41587233 ATGGAAGGGTCCAGGGAGCAAGG - Intronic
954699042 3:52442112-52442134 ATGGGAATGTTCAGGCAGCAGGG + Intronic
954935006 3:54318367-54318389 ATGGATGTTTTCAGGGAGCGGGG + Intronic
955514893 3:59716638-59716660 ACAGCGATGTTCAGGGAACAAGG - Intergenic
955516351 3:59730180-59730202 ATGGAAATGAGCAGGGAGCTGGG - Intergenic
955539543 3:59959941-59959963 ATGTAGAGGTTCATGGAGGAAGG + Intronic
956029582 3:65023201-65023223 AAGGAGCTGTACAGGGTGCAAGG + Intergenic
956552598 3:70478674-70478696 ACAGCGATGTTCAGGGAACAAGG + Intergenic
957220121 3:77371395-77371417 ATAGAGATGTAAAGGGAGAAGGG - Intronic
957756226 3:84491887-84491909 ACAGTGATGTTCAGGGAACAAGG + Intergenic
957778904 3:84793105-84793127 ACAGAGATGTTCAGGGGACAAGG + Intergenic
958440454 3:94150031-94150053 CTGGAGAGGTCCAAGGAGCAAGG + Intergenic
958647046 3:96887480-96887502 GTGGAGGTGGCCAGGGAGCAGGG + Intronic
960088453 3:113615152-113615174 AAGAGGCTGTTCAGGGAGCAGGG - Intronic
960739441 3:120816854-120816876 TTGGAGAGGATCAGGGCGCAAGG + Intergenic
960889823 3:122435922-122435944 ACAGCGATGTTCAGGGAACAAGG + Intronic
962060998 3:131927388-131927410 ATGGAGATGTGATGGGAGAAGGG - Intronic
962105970 3:132389722-132389744 ATCGAGATGTTCAGCCAGCCTGG + Intergenic
962842847 3:139251467-139251489 ATGGAGATAGTCAAGGAGTAAGG - Intronic
962912129 3:139862745-139862767 ACAGCGATGTTCAGGGAACAAGG + Intergenic
963499961 3:146113801-146113823 ACAGCGATGTTCAGGGAACAAGG + Intronic
964115741 3:153134368-153134390 ATGGTGACCTTCTGGGAGCAAGG - Intergenic
964908115 3:161743696-161743718 ACAGCGATGTTCAGGGAACAAGG + Intergenic
965928956 3:174018203-174018225 ACAGTGATGTTCAGGGAACAAGG - Intronic
968136480 3:196223456-196223478 ATGGAGATTTTCACGGAGCAGGG + Intronic
968174061 3:196533762-196533784 ACAGCGATGTTCAGGGAACAAGG - Intergenic
968265407 3:197359113-197359135 ATGGAGAGGTTCACGCAGTAAGG + Intergenic
971267387 4:25107457-25107479 AGGAGGATGTTCATGGAGCATGG + Intergenic
972420011 4:38878242-38878264 ATGCAGCTGTGCAGGGTGCAGGG + Exonic
973040175 4:45460117-45460139 ACAGAGATTTTCAGGGAACAAGG + Intergenic
973798172 4:54449985-54450007 ACAGCGATGTTCAGGGAACAAGG + Intergenic
975402501 4:73953825-73953847 ACAGTGATGTTCAGGGAACAAGG - Intergenic
975587477 4:75964997-75965019 ACAGCGATGTTCAGGGAACAAGG + Intronic
976100029 4:81551398-81551420 CTGTAGATTTTCAGGGAGAAAGG - Intronic
976101177 4:81565575-81565597 ATGGAAATGTTGAGAGAGAAAGG - Intronic
976437403 4:85033826-85033848 ACAGCGATGTTCAGGGAACAAGG + Intergenic
976513777 4:85940557-85940579 ATGGAAATGTCAAGGGAGAATGG + Intronic
976693081 4:87889551-87889573 ACAGCGATGTTCAGGGAACAAGG - Intergenic
976983019 4:91255963-91255985 ACAGAGATGTTCAGGGAACAAGG + Intronic
978239340 4:106497141-106497163 ATGGAAAAGTGCAGGGAGTAAGG + Intergenic
978854667 4:113380828-113380850 ATGGAGATGGTGGGGGAGGAAGG - Intronic
979993795 4:127407420-127407442 ACAGCGATGTTCAGGGAACAAGG + Intergenic
981648928 4:147033886-147033908 ATGCACATGTTAAGGGAGGAAGG + Intergenic
982373554 4:154661124-154661146 ATGAAATTGTTCAAGGAGCAAGG - Intronic
982903852 4:161043157-161043179 ACAGCGATGTTCAGGGAACAAGG - Intergenic
984548123 4:181130722-181130744 ACAGCGATTTTCAGGGAGCAAGG - Intergenic
985295600 4:188434198-188434220 ATGGGGATGTACAGGGTTCAGGG - Intergenic
985611515 5:892245-892267 ATGGAGCTGCTGCGGGAGCAAGG + Intronic
987571964 5:19675601-19675623 AGAGTGATGTTCAGGGAACAAGG - Intronic
987689712 5:21251410-21251432 ACAGCGATGTTCAGGGAACAAGG + Intergenic
988720240 5:33870109-33870131 ACAGTGATGTTCAGGGAACAAGG - Intronic
989513950 5:42320002-42320024 ACAGCGATGTTCAGGGAACAAGG - Intergenic
990234541 5:53752662-53752684 ACAGCGATGTTCAGGGAACAAGG - Intergenic
990322954 5:54647902-54647924 ATGGAGATGTCAAGGGTGAATGG + Intergenic
991250745 5:64558627-64558649 ATAGCAATGTTCAGGGAACAAGG + Intronic
991719069 5:69479126-69479148 ATGGTGATGTTCTGGGAGTGGGG - Intergenic
994570913 5:101512982-101513004 ACAGCGATGTTCAGGGAACAAGG + Intergenic
994744722 5:103664231-103664253 ACAGCGATGTTCAGGGAACAAGG - Intergenic
995845619 5:116490699-116490721 AGGGAGAGGTTCAGGAAGCCAGG + Intronic
998038647 5:138937114-138937136 ATGGAGGAGCCCAGGGAGCAAGG - Intergenic
998369048 5:141649601-141649623 ATGGTGTTGGTCAGGGGGCAGGG - Intronic
998522055 5:142810079-142810101 TTGGAGATGATCAGGTTGCAGGG - Intronic
999308660 5:150537253-150537275 ACAGCGATGTTCAGGGAACAAGG + Intronic
1000335021 5:160235687-160235709 CTGGAGAGCTTCAGGGAGGAGGG - Intronic
1000800145 5:165715528-165715550 TTGAGGATCTTCAGGGAGCAGGG + Intergenic
1001812209 5:174637421-174637443 ATGGATATTTTCACAGAGCAGGG - Intergenic
1004112692 6:12735186-12735208 ATGGAGAGGCTCATGTAGCAAGG - Intronic
1007354086 6:41297767-41297789 ATGGTGATTTTCAGGGAACAAGG - Intergenic
1007707560 6:43799999-43800021 ATGGAGATGGTGAGAGAGGAAGG + Intergenic
1007725667 6:43914323-43914345 CTGGGGATTTTCTGGGAGCAGGG - Intergenic
1008769367 6:54960854-54960876 GTGGAGAAGTGCTGGGAGCATGG + Intergenic
1010772549 6:79848137-79848159 CTGGACATGTCCAGGGAGCTAGG - Intergenic
1011881832 6:92038097-92038119 ATTAAGTTGCTCAGGGAGCAGGG - Intergenic
1016199238 6:141387546-141387568 ATGGAGATGTGCAAGGAGATAGG - Intergenic
1017018308 6:150118924-150118946 AGGAAGCTCTTCAGGGAGCAAGG + Intergenic
1018428903 6:163708207-163708229 ATGGAGATGTTCTGGGCTCAGGG + Intergenic
1018864202 6:167734824-167734846 CTGGAGATGTCCTGGGACCAGGG - Intergenic
1019879543 7:3846504-3846526 AGTGAGGTGTGCAGGGAGCAGGG - Intronic
1020068605 7:5210276-5210298 ATGGAGATGTGTAGGAAGAATGG - Intronic
1020441160 7:8218300-8218322 ATGGAGAAGTTCAGGAAGGTAGG - Exonic
1020603553 7:10306862-10306884 ACAGTGATGTTCAGGGAACAAGG + Intergenic
1020705388 7:11537616-11537638 ATGGCGCTGTACAGGAAGCATGG - Intronic
1020901203 7:14005531-14005553 ATAGAGATCATCAGGGAGAAGGG - Intergenic
1023416224 7:39935508-39935530 TTGCAGAGGTTCAGGGAGGAAGG - Intergenic
1023709663 7:42978000-42978022 CTGCAGCTGTTCAGGTAGCATGG - Intergenic
1023730495 7:43187141-43187163 ATGGAGAGGTCCAGGTAGCAAGG - Intronic
1024217119 7:47256928-47256950 ATGGAGACGGTGAGGGAGGAGGG + Intergenic
1024586840 7:50849529-50849551 AAGGACATGCACAGGGAGCAGGG - Intergenic
1025870090 7:65423258-65423280 ACAGTGATGTTCAGGGAACAAGG + Intergenic
1026154922 7:67818395-67818417 ATGGAGATGTTCAGCTAGCGGGG + Intergenic
1026989454 7:74575369-74575391 ATGGAGATGGACAGGGAAGATGG + Intronic
1028066983 7:86398153-86398175 AAGGAGATAGTCAGGGAGCAGGG - Intergenic
1028435158 7:90794629-90794651 ACAGCGATGTTCAGGGAACAAGG - Intronic
1028573996 7:92325556-92325578 GTTTAGATGTTCAGGGAGAAAGG - Intronic
1028637673 7:93007850-93007872 ATGGAGATGGTGATGGGGCAGGG - Intergenic
1031636120 7:124103257-124103279 ACAGCGATGTTCAGGGAACAAGG + Intergenic
1032083545 7:128872162-128872184 ATGGAGATATACAGAGAACAAGG - Intronic
1032593560 7:133215931-133215953 ATGCAGAAGTTCAGGGACCTAGG + Intergenic
1032723472 7:134569939-134569961 ACAGCGATGTTCAGGGAACAAGG + Intronic
1033417851 7:141179968-141179990 ATGGAGGTGGTTTGGGAGCATGG - Intronic
1033522209 7:142172271-142172293 ATAGAGACATTCAGGGGGCAAGG + Intronic
1034232120 7:149538733-149538755 ATGAAGAGGTACATGGAGCAAGG + Intergenic
1034941963 7:155236542-155236564 ATGGAGATGTGCACAGGGCAGGG - Intergenic
1035572890 8:685324-685346 ACAGCGATGTTCAGGGAACAAGG - Intronic
1037122902 8:15310578-15310600 ATAGAGAAGGTCAGGGAGCACGG - Intergenic
1037573092 8:20175211-20175233 ATGGAGATGTTCAGGGAGCAAGG - Intronic
1037927750 8:22857833-22857855 ATGGAGAAGAACAGGGGGCAAGG + Intronic
1039364348 8:36914651-36914673 ATGGAGATGTCCAGGAGGCCTGG - Intronic
1040139361 8:43892933-43892955 ATAGCGATTTTCAGGGAACAAGG + Intergenic
1040290241 8:46120472-46120494 ATGCAGATGTTCTGGGAGGTAGG - Intergenic
1040840060 8:51775819-51775841 ACAGCGATGTTCAGGGAACAAGG + Intronic
1041103632 8:54420600-54420622 ATGGTGACCTTCTGGGAGCAGGG + Intergenic
1041253372 8:55956690-55956712 ATAGACATGTTCAAGGAGCAAGG - Intronic
1041403192 8:57466172-57466194 ATGGAGGTGTTCAGTCAGCATGG + Intergenic
1041886060 8:62809150-62809172 ACAGCGATGTTCAGGGAACAAGG - Intronic
1042084442 8:65092454-65092476 ACAGCGATGTTCAGGGAACAAGG + Intergenic
1043144998 8:76641932-76641954 ACAGAGATTTTCAGGGAACAAGG - Intergenic
1043324386 8:79032960-79032982 ACAGTGATGTTCAGGGAACAAGG + Intergenic
1044064057 8:87676973-87676995 ACAGCGATGTTCAGGGAACAAGG - Intergenic
1044170314 8:89043357-89043379 ACAGCGATGTTCAGGGAACAAGG + Intergenic
1044590382 8:93908506-93908528 ACAGTGATGTTCAGGGAACAAGG - Intronic
1045431411 8:102118269-102118291 CTGGAGTTGTTCAGGGGACAGGG - Intronic
1046187816 8:110746292-110746314 ACAGCGATGTTCAGGGAACAAGG + Intergenic
1046191356 8:110798935-110798957 ACAGTGATTTTCAGGGAGCAAGG - Intergenic
1046342630 8:112879046-112879068 ACAGTGATGTTCAGGGAACAGGG + Intronic
1047827359 8:128592063-128592085 ATGAACATGTTCAGGCATCAAGG - Intergenic
1048961784 8:139585670-139585692 ATGCAGATTTTCAGTGATCACGG - Intergenic
1049240190 8:141533819-141533841 ATGGAGCTGTGCAGGGAGCCAGG + Intergenic
1050401359 9:5259258-5259280 ACAGCGATGTTCAGGGAACAAGG + Intergenic
1050606679 9:7309064-7309086 ACGGCGATGTTCAGGGAACAAGG + Intergenic
1052125949 9:24774608-24774630 ATAGTGATTTTCAGGGAACAAGG - Intergenic
1053790457 9:41682901-41682923 CTGGAGATGTCCAGGGATGAAGG - Intergenic
1054178802 9:61894600-61894622 CTGGAGATGTCCAGGGATGAAGG - Intergenic
1054658735 9:67686231-67686253 CTGGAGATGTCCAGGGATGAAGG + Intergenic
1055343861 9:75313561-75313583 ACAGCGATGTTCAGGGAACAAGG - Intergenic
1055518138 9:77053765-77053787 ATGGAGATGGAGAGGGAGTAGGG - Intergenic
1056176516 9:84041827-84041849 ACAGCGATGTTCAGGGAACAAGG + Intergenic
1057171153 9:92963975-92963997 GTGTAGATCTTCAGGGAGGAGGG - Intronic
1057295010 9:93829762-93829784 ATGGAGGGGTTCAAGGAGCCGGG + Intergenic
1058253304 9:102729371-102729393 ACAGCGATGTTCAGGGAACAAGG - Intergenic
1058718034 9:107739721-107739743 GTGGAGGCTTTCAGGGAGCACGG + Intergenic
1059540307 9:115123686-115123708 AGGGAAATGTCCAGGGTGCATGG + Intergenic
1059540756 9:115127998-115128020 ATGGAGATGACCAGATAGCAGGG + Intergenic
1059584959 9:115596120-115596142 ATGGAGAAGTTCAAGGCGCTTGG - Intergenic
1059829915 9:118083812-118083834 ATGAAGATGTTGAGTGAACAGGG + Intergenic
1059906483 9:118992167-118992189 CTGAAGAAGCTCAGGGAGCAGGG + Intergenic
1060755838 9:126212760-126212782 AAGGTGGTGTTCAGGGAGGAGGG + Intergenic
1061948282 9:133920862-133920884 TTGGGGATGTTCAGGGTGCTTGG - Intronic
1061989727 9:134152430-134152452 ATGGAGGTGTCCTGGGGGCACGG + Intronic
1185632201 X:1523368-1523390 AGGGAGATGATTAGGGACCAAGG - Intronic
1186803645 X:13117944-13117966 ACAGCGATGTTCAGGGAACAAGG - Intergenic
1188446261 X:30256095-30256117 ACAGCGATGTTCAGGGAACAAGG - Intergenic
1188752955 X:33926191-33926213 ACAGCGATGTTCAGGGAACAAGG + Intergenic
1188822797 X:34796377-34796399 ACAGCGATGTTCAGGGAACAAGG + Intergenic
1189557634 X:42162020-42162042 ACAGTGATGTTCAGGGAACAAGG - Intergenic
1190152835 X:47962439-47962461 ACAGCGATGTTCAGGGAACAAGG - Intronic
1191253182 X:58268913-58268935 AGGGGGATGTTAAGGCAGCACGG - Intergenic
1191596183 X:62946437-62946459 ACAGCGATGTTCAGGGAACAAGG - Intergenic
1191722029 X:64239131-64239153 ACAGCGATGTTCAGGGAACAAGG - Intergenic
1192333631 X:70199928-70199950 ATGGAGCTGAGTAGGGAGCAAGG - Intronic
1193909953 X:87292096-87292118 ATGGAGATATTCAGGGAAGGAGG - Intergenic
1193994268 X:88345288-88345310 ACAGCGATGTTCAGGGAGCAAGG - Intergenic
1194051727 X:89077839-89077861 GTGGAGTTCTTCAGGGAACAGGG + Intergenic
1195365061 X:104117033-104117055 GTGGGGATGTGCATGGAGCAGGG - Intronic
1196275042 X:113756799-113756821 ATGGAGATATTCTGGGAGCATGG + Intergenic
1196654431 X:118202240-118202262 ATGGAGAGGTACATGTAGCAAGG - Intergenic
1197071634 X:122305992-122306014 ACAGAGATGTTCAGGGAACAAGG + Intergenic
1197358418 X:125466966-125466988 ACAGCGATTTTCAGGGAGCAAGG + Intergenic
1197542038 X:127776190-127776212 ATAGCGATTTTCAGGGAACAAGG + Intergenic
1198994676 X:142560925-142560947 ACAGTGATGTTCAGGGAACAAGG + Intergenic
1199595553 X:149503776-149503798 ATGAGGGGGTTCAGGGAGCAGGG + Intronic
1199788650 X:151128931-151128953 ATGCAGAAGTTCAGGAACCATGG - Intergenic
1200158723 X:153993176-153993198 ATGGAGAGCTTCAAGCAGCAGGG - Intergenic
1201343050 Y:12954447-12954469 ACAGCGATGTTCAGGGAACAAGG - Intergenic
1201777991 Y:17687472-17687494 ACAGTGATGTTCAGGGAACAAGG + Intergenic
1201823567 Y:18218520-18218542 ACAGTGATGTTCAGGGAACAAGG - Intergenic
1202265893 Y:23018889-23018911 ACAGCGATGTTCAGGGAACAAGG + Intergenic
1202418886 Y:24652632-24652654 ACAGCGATGTTCAGGGAACAAGG + Intergenic
1202451900 Y:25017454-25017476 ACAGCGATGTTCAGGGAACAAGG - Intergenic